CD97 is a Critical Regulator of Acute Myeloid Leukemia Stem Cell Function
Ontology highlight
ABSTRACT:
PROVIDER: PRJNA557192 | ENA |
REPOSITORIES: ENA
Dataset's files
| Action | DRS | |||
|---|---|---|---|---|
| SRR9853960_1.fastq.gz | Fastqsanger.gz | |||
| SRR9853960_2.fastq.gz | Fastqsanger.gz | |||
| SRR9853970_1.fastq.gz | Fastqsanger.gz | |||
| SRR9853970_2.fastq.gz | Fastqsanger.gz | |||
| SRR9853961_1.fastq.gz | Fastqsanger.gz |
Items per page: 5 1 - 5 of 40 |
Similar Datasets
Project description:Relapse is one of the biggest challenges in treating acute myeloid leukemia (AML) due to leukemia stem cells (LSCs) resisting chemotherapy, providing a cellular reservoir to form the basis for relapse. Here, we identify CaMK2D is a critical regulator of stemness and leukemogenesis of AML. Transcriptionally, loss of CaMK2D was associated with down-regulation kinds of metabolic pathway of AML.
2021-11-08 | GSE161032 | GEO
Project description:Despite significant efforts to improve therapies for acute myeloid leukemia (AML), clinical outcomes remain poor. Understanding the mechanisms that regulate the development and maintenance of leukemic stem cells (LSC) is important to reveal new therapeutic opportunities. We have identified CD97, a member of the adhesion class of G-protein coupled receptors (GPCRs), as a frequently upregulated antigen of AML blasts that is a critical regulator of blast function. High levels of CD97 correlate with poor prognosis, and silencing of CD97 reduces disease aggressiveness in vivo. In order to analyze the functional pathways associated with CD97 expression, we generated RNA-sequence data from scrambled shRNA transfected (s-shRNA) and CD97 KD human AML cell line HL60, as well as from MLL-AF9 (MA9) transduced GMPs isolated from CD97-/- and WT mice. These phenotypes are due to CD97’s function to promote proliferation, survival, and the maintenance of the undifferentiated state in leukemic blasts. Collectively, our data credential CD97 as a promising therapeutic target on LSCs in AML.
2019-07-30 | GSE135028 | GEO
Project description:CaMK2D is a critical regulator of coactivation of leukemia stem cell factors in acute myeloid leukemia.
| PRJNA675223 | ENA
Project description:Cooperative dependencies between mutant oncoproteins and wild-type proteins are critical in cancer pathogenesis and therapy resistance. Although spleen tyrosine kinase (SYK) has been implicated in hematologic malignancies, it is rarely mutated. We used kinase activity profiling to identify collaborators of SYK in acute myeloid leukemia (AML) and determined that FMS-like tyrosine kinase 3 (FLT3) is transactivated by SYK via direct binding. Highly activated SYK is predominantly found in FLT3-ITD positive AML and cooperates with FLT3-ITD to activate MYC transcriptional programs. FLT3-ITD AML cells are more vulnerable to SYK suppression than FLT3 wild-type counterparts. In a FLT3-ITD in vivo model, SYK is indispensable for myeloproliferative disease (MPD) development, and SYK overexpression promotes overt transformation to AML and resistance to FLT3-ITD-targeted therapy. HL-60, MOLM-14, and U937 cell lines were transduced in triplicate with a control luciferase-directed shRNA (target sequence CCTAAGGTTAAGTCGCCCTCG), and in duplicate with two SYK-directed shRNAs: shSYK_1 (clone ID TRCN0000197257, target sequence GCAGCAGAACAGACATGTCAA) and shSYK_2 (clone ID TRCN0000003163 , target sequence GCAGGCCATCATCAGTCAGAA), and were then selected with 1 µg/ml puromycin 48 hours post-infection. At day 5 post-infection, RNA was extracted and profiled using HT HG-U133A arrays (Affymetrix) at the Broad Institute (Cambridge, MA, USA). The computational analysis of the gene expression data was performed through the Genome Space bioinformatics platform (http://www.genomespace.org).
2014-01-15 | E-GEOD-54065 | biostudies-arrayexpress
Project description:Cooperative dependencies between mutant oncoproteins and wild-type proteins are critical in cancer pathogenesis and therapy resistance. Although spleen tyrosine kinase (SYK) has been implicated in hematologic malignancies, it is rarely mutated. We used kinase activity profiling to identify collaborators of SYK in acute myeloid leukemia (AML) and determined that FMS-like tyrosine kinase 3 (FLT3) is transactivated by SYK via direct binding. Highly activated SYK is predominantly found in FLT3-ITD positive AML and cooperates with FLT3-ITD to activate MYC transcriptional programs. FLT3-ITD AML cells are more vulnerable to SYK suppression than FLT3 wild-type counterparts. In a FLT3-ITD in vivo model, SYK is indispensable for myeloproliferative disease (MPD) development, and SYK overexpression promotes overt transformation to AML and resistance to FLT3-ITD-targeted therapy.
2014-01-15 | GSE54065 | GEO
Project description:Dysregulation of cytokines in the bone marrow microenvironment promotes acute myeloid leukemia cell growth. Due to the complexity and low throughput of in vivo stem-cell based assays, studying the role of cytokines in the bone marrow niche in a screening setting is challenging. Herein, we developed an ex vivo cytokine screen using 11 arrayed molecular barcodes, allowing for a competitive in vivo readout of leukemia-initiating capacity. With this approach, we assessed the effect of 114 murine cytokines on MLL-AF9 acute myeloid leukemia mouse cells and identified the tumor necrosis factor ligand superfamily member 13 (TNFSF13) as a positive regulator of leukemia-initiating cells. By using Tnfsf13-/- recipient mice, we confirmed that TNFSF13 supports leukemia-initiation also under physiological conditions. TNFSF13 was secreted by normal myeloid cells but not by leukemia mouse cells, suggesting that mature myeloid bone marrow cells support leukemia cells by secreting TNFSF13. TNFSF13 supported leukemia cell proliferation in an NF-κB-dependent manner by binding TNFRSF17 and suppressed apoptosis. Moreover, TNFSF13 supported the growth and survival of several human myeloid leukemia cell lines, demonstrating that our findings translate to human disease. Taken together, using arrayed molecular barcoding, we identified a previously unrecognized role of TNFSF13 as a positive regulator of acute myeloid leukemia-initiating cells. The arrayed barcoded screening methodology is not limited to cytokines and leukemia, but can be extended to other types of ex vivo screens, where a multiplexed in vivo read-out of stem cell functionality is needed.
2018-10-30 | GSE104425 | GEO
Project description:Despite significant efforts to improve therapies for acute myeloid leukemia (AML), clinical outcomes remain poor. Understanding the mechanisms that regulate the development and maintenance of leukemic stem cells (LSCs) is important to reveal new therapeutic opportunities. We have identified CD97, a member of the adhesion class of G protein-coupled receptors (GPCRs), as a frequently up-regulated antigen on AML blasts that is a critical regulator of blast function. High levels of CD97 correlate with poor prognosis, and silencing of CD97 reduces disease aggressiveness in vivo. These phenotypes are due to CD97's ability to promote proliferation, survival, and the maintenance of the undifferentiated state in leukemic blasts. Collectively, our data credential CD97 as a promising therapeutic target on LSCs in AML.
| S-EPMC6781010 | biostudies-literature
Project description:Label-free quantitation dataset from 44 representative Acute Myeloid Leukemia (AML) patients from the LAML TCGA dataset, and 6 healthy bone marrow derived controls including 3 lineage-depleted and 3 CD34+ selected bone marrows.
2022-03-09 | MSV000089029 | MassIVE
Project description:A deep-scale proteome and phosphoproteome database from 44 representative Acute Myeloid Leukemia (AML) patients from the LAML TCGA dataset, and 6 healthy bone marrow derived controls including 3 lineage-depleted and 3 CD34+ selected bone marrows.
2022-03-07 | MSV000089012 | MassIVE
Project description:Leukemia initiating cells (LICs) of acute myeloid leukemia (AML) may arise from self-renewing hematopoietic stem cells (HSCs) and from committed progenitors. However, it remains unclear how leukemia-associated oncogenes instruct LIC formation from cells of different origins and if differentiation along the normal hematopoietic hierarchy is involved. Here, using murine models with the driver mutations MLL-AF9 or MOZ-TIF2, we found that regardless of the transformed cell types, myelomonocytic differentiation to the granulocyte macrophage progenitor (GMP) stage is critical for LIC generation. Blocking myeloid differentiation through disrupting the lineage-restricted transcription factor C/EBPa eliminates GMPs, blocks normal granulopoiesis, and prevents AML development. In contrast, restoring myeloid differentiation through inflammatory cytokines “rescues” AML transformation. Our findings identify myeloid differentiation as a critical step in LIC formation and AML development, thus guiding new therapeutic approaches. Primary KSL, CMP, and GMP cells from wildtype controls and C/Ebpa knockouts were used for RNA extraction and hybridization on Affymetrix microarrays. We also compared the microarray samples of leukemic granulocyte macrophage progenitor compartments (L-GMPs) from MLL-AF9 transformed control or cytokine rescued C/EBPa KO leukemic mouse bone marrow and their secondary recipients with those non-Leukemia KSLs and CMPs from MLL-AF9 transduecd KO recipients with no leukemia development.
2014-09-17 | E-GEOD-61468 | biostudies-arrayexpress