Browse
Submit Data
Databases
API
Help

Dataset Information

0 Views

0 Connections

0 Citations

0 Reanalyses

0 Downloads

Omics score: 0

Transcriptome analysis of novel CPT-CEF-treated HT29 colon cancer cells to evaluate drug cytotoxicity

ABSTRACT: Transcriptome analysis of novel CPT-CEF-treated HT29 colon cancer cells to evaluate drug cytotoxicity

PROVIDER: PRJNA698397 | ENA |

REPOSITORIES: ENA

ACCESS DATA

Json Xml

Dataset's files

Source:

			Action	DRS
	SRR13593674_1.fastq.gz	Fastqsanger.gz
	SRR13593674_2.fastq.gz	Fastqsanger.gz
	SRR13593675_1.fastq.gz	Fastqsanger.gz
	SRR13593675_2.fastq.gz	Fastqsanger.gz
	SRR13593676_1.fastq.gz	Fastqsanger.gz

Items per page:

1 - 5 of 8

Similar Datasets

Transcriptome analysis of novel CPT-CEF-treated HT29 colon cancer cells to evaluate drug cytotoxicity

Project description:Purpose: To identify differentially expressed genes in HT29 colon cancer cells after treatment with a novel formulation of camptothecin with β-cyclodextrin-EDTA-Fe3O4 nanoparticle-conjugated nanocarriers (CPT-CEF) Methods:Treated HT29 cell lines with CPT-CEF, isolated total RNA from HT29 colon cancer cells, and prepared library for RNA sequencing. Carried out comparative transcriptomic studies between treated and untreated cells to find out which gene functions were dysregulated by CPT-CEF. Results: The study yielded 247 DEGs ((FDR<0.05, FC>2.0) that were affected by CPT-CEF treatment in the HT29 colon cancer cells. The results obtained from cell cycle analysis, mitochondrial depolarization assay and acridium orange/propidium iodide double staining showed potential of CPT-CEF in cancer cell inhibition. Conclusion: Our study successfully identified DEGs in the CPT-CEF treated HT29 colon cancer cells that pointed to inhibition of cancer progression. To further affirm, animal studies are needed.

2021-09-15 | GSE165875 | GEO

Transcriptome expression changes after knockdown of ALDH1A1 in human colon cancer cells HT29

Project description:Firstly, shRNA (GCCAAATCATTCCTTGGAATT) was used to knock down ALDH1A1 in HT29 cells, and the knockdown effect was verified by western blot. Then the shALDH1A1 HT29 cells were compared with parental HT29 cells by RNA-seq.

2024-08-27 | GSE225822 | GEO

Colon cancer HT29 cells: siHX transfected vs. control

Project description:HT29 cells were transsfected with siRNA (siHX), which is targeting the human endogeous retrovirus HERV-HX. Cells were harvested 72 h after transfection and knock-down of HERV-HX was evaluated by quantitative RT-PCR. Keywords: Genetic modification

2009-01-01 | GSE14257 | GEO

Overexpression of Mitochondrial Aconitase in HT29 Colon Cancer Cells Attenuates beta-Catenin Signaling Pathway via Metabolic Changes of NADPH and ROS

Project description:Our previous proteomics analysis suggested down-regulation of mitochondrial aconitase (ACO2) plays an important role in colorectal cancer. To evaluate the effect of mitochondrial aconitase overexpression on the metabolic and signaling pathway changes in colon cancer cell line HT29, we generated two ACO2 overexpressing cell lines #C and #UD and the mock-transfected vector control #VE. HT29 colon cancer cells overexpressing ACO2 exhibited lower rate of cell proliferation in vitro and reduced tumor growth potential in nude mice. In order to understand the signaling pathway changes, cDNA microarray analysis using GeneChips from Affymetrix were carried out.

2010-01-14 | E-MEXP-1996 | biostudies-arrayexpress

Colon cancer shperes are sensitive to Fenretinide

Project description:Fenretinide has shown its antitumor activity in many tumor types with low cytotoxicity to normal cells. Recently, we have shown that fenretinide could eradicate chronic myeloid leukemia stem/progenitor cells and spheres from ovarian cancer. In this study, we investigate whether fenretinide could selectively target sphere cells of colon cancer. Using high-throughtput microarray system, we identified GO terms and pathway signatures enriched in fenretinide treated HT29 cells and HT29 derived sphere cells. Colon cancer cells HT29 were cultured in sphere formation conditions, HT29 cells and HT29 derived sphere cells were treated with fenretinide, and total RNA from those spheres and corresponding adhered cell was hybridized on Affymetrix U133 plus 2.0 genechip.

2016-04-03 | E-GEOD-66983 | biostudies-arrayexpress

HT29 and GATA6

Project description:HT29 and GATA6

| PRJNA263819 | ENA

Colon cancer shperes are sensitive to Fenretinide

2016-04-03 | GSE66983 | GEO

Transcription profiling of Zea mays embryos under camptothecin (CPT) treatment.

Project description:Camptothecin (CPT) is a plant alkaloid that specifically binds topoisomerase I (Topo I) inhibiting its activity and inducing double stranded breaks in the DNA, activating the genotoxic cell responses, and ultimately, it might trigger programmed cell death (PCD). We used microarrays to detail the changes in gene expression during as a consequence of CPT treatment in maize immature embryos. In four independent experiments immature embryos were plated on MS medium supplemented with 50 uM CPT and incubated during three days. Untreated embryos incubated on MS medium were used as controls.

2010-11-01 | E-MEXP-2702 | biostudies-arrayexpress

Diverse effect of WWOX overexpression in HT29 colon cancer cell line.

Project description:The WWOX gene is a tumor suppressor probably involved in regulation of cell cycle and apoptosis and downregulated in variety of cancer types.However, its role in colon cancerogenesis is unknown. The aim of this study was to characterize how WWOX may be involved in colon cancerogenesis or cancer progression, how it influences the basic cancer cell features and modifies cell expression profile.Our observations suggest that in HT29 colon cancer cell line increased expression of WWOX may result in transition of cancer cells into more normal- like colon epithelium phenotype, on the other hand in SW480 WWOX revealed the well-known tumour suppressor properties. However, as the colon cancer is very heterogeneous disease, obtained discrepancies may reflect the known differences between cell lines and cancerogenesis pathway, which they undergone. HT29 colon cancer cells were stably transfected with WWOX cDNA. HT29 cells transfected with an empty vector served as a control. Total mRNA was isolated to look for gene-expression differences induced by the WWOX overexpression.

2014-01-23 | E-GEOD-54298 | biostudies-arrayexpress

ERbeta modulation of NFkB pathway in colon cancer cell lines SW480 and HT29

Project description:Analysis of differentially expressed genes in colon cancer cell lines SW480 and HT29 with and without stably expressed ERbeta gene, with and without 10ng/mL TNFa treatment for 2 and 24 hours.

2020-08-13 | GSE65979 | GEO

OmicsDI is part of the ELIXIR infrastructure

OmicsDI is an Elixir interoperability service. Learn more ›

Tweets

OmicsDI Databases

PRIDE
PeptideAtlas
MassIVE
JPOST Repository
Physiome Model Repository

EGA
EVA
ENA
LINCS
PAXDB
Cell Collective

MetaboLights
Metabolomics Workbench
MetabolomeExpress
GNPS
BioModels
FAIRDOMHub

ArrayExpress
dbGaP
ExpressionAtlas
GEO
NODE

Information

Databases
Help
API
Contact us
Code on GitHub
Terms of use
Submit Data