Browse
Submit Data
Databases
API
Help

Dataset Information

0 Views

0 Connections

0 Citations

0 Reanalyses

0 Downloads

Omics score: 0

ABSTRACT: 16S rDNA High throughput sequencing of soil

PROVIDER: PRJNA728746 | ENA |

REPOSITORIES: ENA

ACCESS DATA

Json Xml

Dataset's files

Source:

			Action	DRS
	SRR14491800_1.fastq.gz	Fastqsanger.gz
	SRR14491800_2.fastq.gz	Fastqsanger.gz
	SRR14491801_1.fastq.gz	Fastqsanger.gz
	SRR14491801_2.fastq.gz	Fastqsanger.gz
	SRR14491802_1.fastq.gz	Fastqsanger.gz

Items per page:

1 - 5 of 144

Similar Datasets

Project description:16S rDNA High throughput sequencing of soil

| PRJNA638003 | ENA

Project description:Soil 16S high-throughput sequencing

| PRJNA967487 | ENA

Project description:18S rDNA High throughput sequencing of soil

| PRJNA722569 | ENA

Project description:soil 16S rRNA high-throughput sequencing

| PRJNA776560 | ENA

High-throughput sequencing of in vitro fecal fermentation samples

Project description:We report the use of high-throughput sequencing technology to detect the microbial composition and abundance of human feces after in vitro co-fermentation with citrus peel flavonoid extracts. The genomic DNA was obtained by the QIAamp PowerFecal DNA Kit. Then, the DNA samples were sent to Biomarker Bio-Tech (Beijing, China) for V3-V4 region of the 16S rDNA gene high-throughput sequencing with an Illumina MiSeq platform. DNA samples were sequenced using primers 338F (forward primer sequence ACTCCTACGGGAGGCAGCAG)-806R (reverse primer sequence GGACTACHVGGGTWTCTAAT). A total of 8,816,250 pairs of Reads were obtained from the 112 samples sequenced, and 8,721,112 Clean Reads were generated from the double-ended Reads after quality control and splicing. The sequencing analyses were carried out using the SILVA database as a reference for the assignation of operational taxonomic units (OTUs) with 97% of identity.

2022-04-02 | GSE199749 | GEO

Project description:high-throughput sequencing soil 16S rRNA gene

| PRJNA800347 | ENA

16S rDNA Amplicon Sequencing Analysis of Polystyrene Microplastic Exposed Zebrafish Intestine

Project description:Microplastics (MPs) as widespread contamination pose high risk for aquatic organisms.Intestinal microbiotahas have high interaction with immune system of host body. In this study, intestinal microbiota of zebrafish after Polystyrene (PS-MPs) exposure were characterized by 16S rDNA amplicon sequencing. We found that 100nm and 200μm PS-MPs exposure significantly increased diversity of intestinal microbiota and all the three sizes of PS-MPs increased abundance of pathogenic bacteria.

2019-10-01 | GSE136108 | GEO

16S rDNA (v3-v4 region) sequencing of the cecal bacteria in control (CTL) and chronic nonbacterial prostatitis (CNP) rats

Project description:Prostate of SD rats was injected with 0.1 ml 1% carrageenan to induce chronic nonbacterial prostatitis, and the control rats injected with sterile saline. Then, the cecal contents were collected for 16S rDNA sequencing.

2021-07-07 | GSE179639 | GEO

Project description:16s rDNA high-throughput sequencing of ileum, colon, and cecum contents

| PRJNA656109 | ENA

Project description:16S rDNA high-throughput sequencing of faces on diabetic osteoporosis rat

| PRJNA921742 | ENA