Ontology highlight
ABSTRACT:
PROVIDER: PRJNA921742 | ENA |
REPOSITORIES: ENA
Similar Datasets
Project description:Osteoporosis is a significant health concern, and the role of microRNAs (miRNAs) in cell growth and development regulation is well recognized. High-throughput sequencing technology is widely employed in current research. This study aimed to identify and validate miRNAs associated with osteoporosis. Bone specimens were collected from patients with osteoporosis (n=3) and without osteoporosis (n=3). High-throughput sequencing was utilized to screen for miRNAs, followed by analysis using volcano maps, Wayne maps, gene ontology (GO) analysis, and Kyoto Encyclopedia of Genes and Genomes (KEGG) analysis. The identified miRNAs were further confirmed using qRT-PCR. Sequencing analysis revealed 12 down-regulated and five upregulated miRNAs in osteoporosis. GO and KEGG analysis indicated the association of these miRNAs with bone metabolism. qRT-PCR results demonstrated a significant decrease in miR-140-5p, miR-127-3p, miR-199b-5p, miR-181a-5p, miR-181d-5p, and miR-542-3p (all P<0.05) in osteoporosis compared to controls, while miR-486-3p and miR-486-5p exhibited a significant increase (P<0.05). This study utilized high-throughput sequencing to identify differential miRNA expression in individuals with osteoporosis. Specifically, six miRNAs (miR-140-5p, miR-127-3p, miR-199b-5p, miR-181a-5p, miR-181d-5p, and miR-542) showed decreased expression, whereas two miRNAs (miR-486-3p and miR-486-5p) exhibited increased expression. The differential expression of these miRNAs may serve as predictive indicators, potentially aiding in the prognosis and management of osteoporosis.
2024-08-28 | GSE273345 | GEO
Project description:We report the use of high-throughput sequencing technology to detect the microbial composition and abundance of human feces after in vitro co-fermentation with citrus peel flavonoid extracts. The genomic DNA was obtained by the QIAamp PowerFecal DNA Kit. Then, the DNA samples were sent to Biomarker Bio-Tech (Beijing, China) for V3-V4 region of the 16S rDNA gene high-throughput sequencing with an Illumina MiSeq platform. DNA samples were sequenced using primers 338F (forward primer sequence ACTCCTACGGGAGGCAGCAG)-806R (reverse primer sequence GGACTACHVGGGTWTCTAAT). A total of 8,816,250 pairs of Reads were obtained from the 112 samples sequenced, and 8,721,112 Clean Reads were generated from the double-ended Reads after quality control and splicing. The sequencing analyses were carried out using the SILVA database as a reference for the assignation of operational taxonomic units (OTUs) with 97% of identity.
2022-04-02 | GSE199749 | GEO
Project description:Gene expression profiles in the liver of 9-week-old wild type and diabetic db/db mice were measured by high-throughput sequencing to detect the differentially expressed genes Gene expression profiles of 9-week-old wild type and diabetic db/db mice were generated by high-throughput sequencing using Illumina Genome Analyzer
2013-11-12 | E-GEOD-43314 | biostudies-arrayexpress
Project description:Microplastics (MPs) as widespread contamination pose high risk for aquatic organisms.Intestinal microbiotahas have high interaction with immune system of host body. In this study, intestinal microbiota of zebrafish after Polystyrene (PS-MPs) exposure were characterized by 16S rDNA amplicon sequencing. We found that 100nm and 200μm PS-MPs exposure significantly increased diversity of intestinal microbiota and all the three sizes of PS-MPs increased abundance of pathogenic bacteria.
2019-10-01 | GSE136108 | GEO
Project description:Prostate of SD rats was injected with 0.1 ml 1% carrageenan to induce chronic nonbacterial prostatitis, and the control rats injected with sterile saline. Then, the cecal contents were collected for 16S rDNA sequencing.
2021-07-07 | GSE179639 | GEO
Project description:Seagrass meadows sediments 16S rDNA high throughput sequencing Raw sequence reads
| PRJNA689671 | ENA