Browse
Submit Data
Databases
API
Help

Dataset Information

0 Views

0 Connections

0 Citations

0 Reanalyses

0 Downloads

Omics score: 0

ABSTRACT: pig intestinal contents 16S rRNA

PROVIDER: PRJNA742475 | ENA |

REPOSITORIES: ENA

ACCESS DATA

Json Xml

Dataset's files

Source:

			Action	DRS
	SRR14998313_1.fastq.gz	Fastqsanger.gz
	SRR14998313_2.fastq.gz	Fastqsanger.gz
	SRR14998314_1.fastq.gz	Fastqsanger.gz
	SRR14998314_2.fastq.gz	Fastqsanger.gz
	SRR14998315_1.fastq.gz	Fastqsanger.gz

Items per page:

1 - 5 of 12

Similar Datasets

Project description:16S rRNA analyse of tilapia intestinal contents.

| PRJNA722679 | ENA

Feces 16S rRNA seq of mice treated by AZ1 with 2.5% DSS or H2O

Project description:Feces 16s rRNA seq experiments is required to demonstrate the AZ1 doesn’t impact the intestinal microbiota.

2020-02-14 | GSE143003 | GEO

Project description:16s rRNA-seq of Rattus norvegicus Intestinal contents

| PRJNA632739 | ENA

4089b0bc-852b-46f9-856c-6d43cc08ad61 - samples

Project description:Metadata for 16S-V4 rRNA gene sequence data for intestinal biopsies from NCT02749630 trial participants.

| EGAD00001008823 | EGA

Project description:16S rRNA-seq of normal guinea pig intestinal segments

| PRJNA832914 | ENA

WBSCR16 Deficiency Drives Adaptive Metabolic Flexibility Via Impaired Mitochondrial 16S rRNA Maturation

Project description:Mitochondrial rRNAs play important roles in regulating mtDNA-encoded gene expression and energy metabolism subsequently. However, the proteins that regulate mitochondrial 16S rRNA processing remain poorly understood. Herein, we generated adipose-specific Wbscr16-/- mice and cells, both of which exhibited dramatic mitochondrial changes. Subsequently, WBSCR16 was identified as a 16S rRNA-binding protein essential for the cleavage of 16S rRNA-mt-tRNALeu, facilitating 16S rRNA processing and mitochondrial ribosome assembly. Additionally, WBSCR16 recruited RNase P subunit MRPP3 to nascent 16S rRNA and assisted in this specific cleavage. Furthermore, evidence showed that adipose-specific Wbscr16 ablation promotes energy wasting via lipid preference in brown adipose tissue, leading to excess energy expenditure and resistance to obesity. In contrast, overexpression of WBSCR16 upregulated 16S rRNA processing and induced a preference for glucose utilization in both transgenic mouse models and cultured cells. These findings suggest that WBSCR16 plays essential roles in mitochondrial 16S rRNA processing in mammals, and is the key mitochondrial protein to balance glucose and lipid metabolism.

2024-12-30 | GSE229693 | GEO

2bddd27c-e07d-4dae-9c16-5040b0626d57 - samples

Project description:16S-V4 rRNA gene sequence data for intestinal biopsies from NCT02749630 trial participants. Biopsies from patients were collected at screening, day 30, and day 85 and prepared for 16SV4 rRNA gene sequencing.

| EGAD00001008843 | EGA

Hhigh-throughput sequencing of in vitro fecal fermentation samples

Project description:We report the use of high-throughput sequencing technology to detect the microbial composition and abundance of mice grastic contents before and after Helicobacter pylori infection or Lactobacillus paracasei ZFM54 pretreatment/treatment. The genomic DNA was obtained by the QIAamp PowerFecal DNA Kit. Then, the DNA samples were sent to BGI Genomics Co., Ltd. (Shenzhen, China) for V3-V4 region of the 16S rRNA gene high-throughput sequencing with an Illumina MiSeq platform. DNA samples were sequenced using primers 338F (forward primer sequence ACTCCTACGGGAGGCAGCAG)-806R (reverse primer sequence GGACTACHVGGGTWTCTAAT). The sequencing analyses were carried out using silva138/16s database as a reference for the assignation of Amplicon Sequence Variant (ASV) at 100% similarity.

2022-07-27 | GSE208665 | GEO

Project description:Colonic contents sample 16S rRNA sequencing

| PRJNA597824 | ENA

Project description:16S rRNA of mouse cecum contents

| PRJNA1104429 | ENA