Browse
Submit Data
Databases
API
Help

Dataset Information

0 Views

0 Connections

0 Citations

0 Reanalyses

0 Downloads

Omics score: 0

BulkRNA sequencing of small intestinal IEC epithelial cells of Casp3/7ΔIEC mice and Casp3/7FL/FL littermates

ABSTRACT: BulkRNA sequencing of small intestinal IEC epithelial cells of Casp3/7ΔIEC mice and Casp3/7FL/FL littermates

PROVIDER: PRJNA762040 | ENA |

REPOSITORIES: ENA

ACCESS DATA

Json Xml

Dataset's files

Source:

			Action	DRS
	SRR15831600.fastq.gz	Fastqsanger.gz
	SRR15831601.fastq.gz	Fastqsanger.gz
	SRR15831602.fastq.gz	Fastqsanger.gz
	SRR15831603.fastq.gz	Fastqsanger.gz
	SRR15831596.fastq.gz	Fastqsanger.gz

Items per page:

1 - 5 of 8

Similar Datasets

BulkRNA sequencing of small intestinal IEC epithelial cells of Casp3/7ΔIEC mice and Casp3/7FL/FL littermates

Project description:Apoptosis is widely believed to be crucial for epithelial cell death and shedding in the intestine, thereby shaping the overall architecture of the gastrointestinal tract, but also regulating tolerance induction during homeostasis. To experimentally address this concept, we generated intestinal epithelial cell (IEC)-specific knockout mice that lack both executioner caspase-3 and caspase-7 (Casp3/7?IEC), which are the converging point of the extrinsic and intrinsic apoptotic pathway. Surprisingly, the overall architecture, cellular landscape and proliferation rate remained unchanged in these mice. However, non-apoptotic cell extrusion was increased in Casp3/7?IEC mice, compensating apoptosis deficiency, maintaining the same physiological level of IEC shedding. Microbiome richness and composition stayed unaffected, bearing no sign of dysbiosis. Transcriptome and single cell RNA sequences analyses of IECs and immune cells revealed no differences in signaling pathways of differentiation and inflammation. These findings demonstrate that during homeostasis apoptosis per se is dispensable for IEC turnover at the top of intestinal villi intestinal tissue dynamics, microbiome composition and immune regulation.

2022-01-01 | GSE183811 | GEO

Expression profile of WT and IKKb(EE)IEC epithelial cells (IEC)

Project description:To investigate NF-kB-driven gene expression in IEC, we performed microarray analysis from enterocytes of mice that express a constitutively active form of IKKb in intestinal epithelial cells Total RNA was prepared from enterocytes obtained from small intestines of IKKb(EE)IEC and WT littermates. Two biological replicates were performed for each experimental condition.

2011-06-09 | E-GEOD-29701 | biostudies-arrayexpress

Quantitative proteomic TandemMassTag analysis of intestinal epithelial cells (IEC) deleted for both Hdac1 and Hdac2

Project description:We have performed quantitative proteomic TandemMassTag to investigate proteomic changes after deletion of epigenetic eraser genes Hdac1 and Hdac2 in intestinal epithelial cells. Both HDAC1 and HDAC2 are epigenetic erasers that drive specific and redundant gene expression patterns, in part by removing acetyl groups on histones. Deletion of these Hdac in intestinal epithelial cell (IEC) in vivo alters intestinal homeostasis, dependent on the Hdac deleted and the level of expression of both. To determine the specific IEC function of HDAC1 and HDAC2, we have performed transcriptomic and quantitative proteomic approaches on IEC deficient in Hdac1 and Hdac2. We have defined changes in both mRNA and protein expression patterns affecting IEC differentiation. We have identified IEC Hdac1- and Hdac2-dependent common as well as specific pathways and biological processes. These findings uncover unrecognized similarities and differences between Hdac1 and Hdac2 in IEC.

2021-09-09 | PXD022558 | Pride

Expression data from Control or ShSuz12 rat Intestinal epithelial cells IEC-6

Project description:Polycomb-group proteins form multimeric protein complexes involved in transcriptional silencing. The Polycomb Repressive complex 2 (PRC2) contains the Suppressor of Zeste-12 protein (Suz12) and the histone methyltransferase Enhancer of Zeste protein-2 (Ezh2). This complex, catalyzing the di- and tri-methylation of histone H3 lysine 27, is essential for embryonic development and stem cell renewal. However, the role of Polycomb-group protein complexes in the control of the intestinal epithelial cell (IEC) phenotype is not known. We investigated the impact of Suz 12 depletion on gene expression in IEC-6 cells. Multiple shRNA lentiviral constructs were tested in IEC-6 cells for their ability to down-regulate Suz12 expression (MISSION shRNA lentiviral transduction particles, SigmaM-bM-^@M-^SAldrich Canada, Oakville, ON). Forty percent confluent cells were infected in medium supplemented with 4 mg/ml polybrene (SigmaM-bM-^@M-^SAldrich Canada) for 6 h. Two days after infection, cell populations were selected with 2 mg/ml puromycin (SigmaM-bM-^@M-^SAldrich Canada). The clone TRCN0000038728 was selected: the shRNA against Suz12 (GCTGACAATCAAATGAATCAT) is conserved in rat (accession number FM084383), murine (accession number NM_199196) and human (accession number NM_015355.2) Suz12 sequences. Efficiency of infection was estimated at 25%. Control or ShSuz12 IEC-6 cell total RNAs were isolated with the Rneasy kit (Qiagen, Mississauga, ON, Canada), according to the manufacturerM-bM-^@M-^Ys instructions. RNA samples from three independent experiments were used for microarray analysis.

2014-08-02 | E-GEOD-60003 | biostudies-arrayexpress

Expression data from colon samples from FADD IEC-KO (intestinal epithelial cell-knock out) and CASP8 IEC-KO mice in combination with different genetic mutations (Zbp1 -/-, Mlkl -/-, Ripk3 IEC-KO)

Project description:FADD-IEC KO and CASP8 IEC-KO mice spontaneously develop chronic colitis charcterized by inflammatory gene expression. We characterized the role of MLKL, RIPK3, ZBP1, in the upregulation of inlflammatory genes in these mice. We used microarray to study the effect of MLKL, RIPK3 and ZBP1 on the gene expression profile in FADD IEC-KO and/or CASP8 IEC-KO mice and detect effects on specific inflammatory genes.

2020-05-01 | GSE137281 | GEO

Expression data from ileum samples from FADD IEC-KO (intestinal epithelial cell-knock out) and CASP8 IEC-KO mice in combination with different genetic mutations (Zbp1 -/-, Mlkl -/-, Ripk3 IEC-KO)

Project description:FADD-IEC KO and CASP8 IEC-KO mice spontaneously develop chronic ileitis charcterized by inflammatory gene expression. We characterized the role of MLKL, RIPK3, ZBP1, in the upregulation of inlflammatory genes in these mice. We used microarray to study the effect of MLKL, RIPK3 and ZBP1 on the gene expression profile in FADD IEC-KO and/or CASP8 IEC-KO mice and detect effects on specific inflammatory genes.

2020-05-01 | GSE137280 | GEO

Expression data from Control or ShSuz12 rat Intestinal epithelial cells IEC-6

2014-08-02 | GSE60003 | GEO

Expression profile of WT and IKKb(EE)IEC epithelial cells (IEC)

2011-06-09 | GSE29701 | GEO

Metabolic effect of the loss of mitochondrial-specific aspartyl-tRNA synthetase Das2 on mouse intestinal epithelial cells

Project description:We analysed the intestinal epithelial cell (IEC) from Dars2 fl/fl ; VillinCreERT2 tg/wt mice (n=15) and and Dars2 fl/fl ; VillinCreERT2 wt/wt mice (n=9) at 8 days upon tamoxifen injection to assess the metabolic effect of Das2 loss. Isolated IECs were divided into three technical replicates (n=69) and analysed with two analytical repeats (n=138).

2022-06-01 | ST002184 | MetabolomicsWorkbench

Role of mitochondria in intestinal epithelial cells

Project description:We aimed to study the role of mitochondria in intestinal epithelial cells by generating and analyzing mice with tamoxifen-inducible intestinal epithelial cell (IEC)-specific knockout of DARS2. DARS2 ablation caused severe mitochondrial dysfunction in IECs and resulted in suppression of epithelial cell proliferation and accumulation of lipids within large lipid droplets in enterocytes. To gain insight into the mechanism underlying the lipid processing defect, we used Lexogen 3' mRNA sequencing to compare the gene expression profiles of the proximal small intestine from mice with IEC-specific DARS2 knockout and control littermates at three days after tamoxifen induction, when the mice do not display yet lipid accumulation, and at seven days after tamoxifen induction, when enterocytes are filled with lipids.

2023-08-29 | GSE207803 | GEO

OmicsDI is part of the ELIXIR infrastructure

OmicsDI is an Elixir interoperability service. Learn more ›

Tweets

OmicsDI Databases

PRIDE
PeptideAtlas
MassIVE
JPOST Repository
Physiome Model Repository

EGA
EVA
ENA
LINCS
PAXDB
Cell Collective

MetaboLights
Metabolomics Workbench
MetabolomeExpress
GNPS
BioModels
FAIRDOMHub

ArrayExpress
dbGaP
ExpressionAtlas
GEO
NODE

Information

Databases
Help
API
Contact us
Code on GitHub
Terms of use
Submit Data