Ontology highlight
ABSTRACT:
PROVIDER: PRJNA855057 | ENA |
REPOSITORIES: ENA
Dataset's files
| Action | DRS | |||
|---|---|---|---|---|
| SRR19986168.fastq.gz | Fastqsanger.gz | |||
| SRR19986169.fastq.gz | Fastqsanger.gz | |||
| SRR19986170.fastq.gz | Fastqsanger.gz | |||
| SRR19986171.fastq.gz | Fastqsanger.gz | |||
| SRR19986172.fastq.gz | Fastqsanger.gz |
Items per page: 5 1 - 5 of 9 |
Similar Datasets
Project description:To determine microbiota composition associated with loss of KDM5 in intestine, we carried out 16S rRNA seq analyses of dissected intestine from wildtype and kdm5 mutant. [GSM2628181-GSM2628190]. A total of 78 operational taxonomic units (OTUs) were identified in the sequence data. There were about 15 genera much less abundant in kdm5 mutant compared to wildtype. The kdm5 mutant were sensitive to pathogen. To confirm the microbiota associated with loss of KDM5 in intestine, 16S rRNA of new flies were sequenced and analyzed by Majorbio Bio-Pharm Technology Co. Ltd. (Shanghai, China) [GSM3243472-GSM3243481]. A total of 107 operational taxonomic units (OTUs) were identified in the sequence data. There were about 20 genera much less abundant in kdm5 mutant compared to wildtype. To confirm the microbiota associated with loss of KDM5 drosophila feeding with Lactobacillus plantarum, 16S rRNA of kdm5 mutant flies were sequenced and analyzed by Novogene Bioinformatics Technology Co., Ltd. (Tianjin, China) [GSM3263522-GSM3263527]. A total of 92 operational taxonomic units (OTUs) were identified in the sequence data. To confirm the microbiota associated with KDM5 knockdown in intestine, 16S rRNA of Myo1A-Gal4TS/+ and Myo1A-Gal4TS/+;+/kdm5RNAi flies were sequenced and analyzed by Biomarker Co. Ltd. (Beijing, China). [GSM3507915-GSM3507924]. A total of 50 operational taxonomic units (OTUs) were identified in the sequence data. There was a significant different based on the genus level between two groups.
2019-02-08 | GSE98944 | GEO
Project description:A combination of shotgun metaproteomics and 16S rRNA gene pyrosequencing wasused to identify potential functional pathways and key microorganisms involved in long-chain fatty acids (LCFA) anaerobic conversion. Microbial communities degrading saturated- and unsaturated-LCFA were compared. Archaeal communities were mainly composed of Methanosaeta, Methanobacterium and Methanospirillum species, both in stearate (saturated C18:0) and oleate (mono-unsaturated C18:1) incubations. Over 80% of the 16S rRNA gene sequences clustered within the Methanosaeta genus, which is in agreement with the high number of proteins assigned to this group (94%). Archaeal proteins related with methane metabolism were highly expressed. Bacterial communities were rather diverse and the composition dissimilar between incubations with saturated- and unsaturated-LCFA. Stearate-degrading communities were enriched in Deltaproteobacteria (34% of the assigned sequences), while microorganisms clustering within the Synergistia class were more predominant in oleate incubation (25% of the assigned sequences). Bacterial communities were diverse and active, given by the high percentage of proteins related with mechanisms of energy production. Several proteins were assigned to syntrophic bacteria, emphasizing the importance of the interactions between acetogens and methanogens in energy exchange and formation in anaerobic LCFA-rich environments.
2024-05-03 | PXD047824 | Pride
Project description:A combination of shotgun metaproteomics and 16S rRNA gene pyrosequencing wasused to identify potential functional pathways and key microorganisms involved in long-chain fatty acids (LCFA) anaerobic conversion. Microbial communities degrading saturated- and unsaturated-LCFA were compared. Archaeal communities were mainly composed of Methanosaeta, Methanobacterium and Methanospirillum species, both in stearate (saturated C18:0) and oleate (mono-unsaturated C18:1) incubations. Over 80% of the 16S rRNA gene sequences clustered within the Methanosaeta genus, which is in agreement with the high number of proteins assigned to this group (94%). Archaeal proteins related with methane metabolism were highly expressed. Bacterial communities were rather diverse and the composition dissimilar between incubations with saturated- and unsaturated-LCFA. Stearate-degrading communities were enriched in Deltaproteobacteria (34% of the assigned sequences), while microorganisms clustering within the Synergistia class were more predominant in oleate incubation (25% of the assigned sequences). Bacterial communities were diverse and active, given by the high percentage of proteins related with mechanisms of energy production. Several proteins were assigned to syntrophic bacteria, emphasizing the importance of the interactions between acetogens and methanogens in energy exchange and formation in anaerobic LCFA-rich environments.
2024-05-03 | PXD047617 | Pride
Project description:A combination of shotgun metaproteomics and 16S rRNA gene pyrosequencing wasused to identify potential functional pathways and key microorganisms involved in long-chain fatty acids (LCFA) anaerobic conversion. Microbial communities degrading saturated- and unsaturated-LCFA were compared. Archaeal communities were mainly composed of Methanosaeta, Methanobacterium and Methanospirillum species, both in stearate (saturated C18:0) and oleate (mono-unsaturated C18:1) incubations. Over 80% of the 16S rRNA gene sequences clustered within the Methanosaeta genus, which is in agreement with the high number of proteins assigned to this group (94%). Archaeal proteins related with methane metabolism were highly expressed. Bacterial communities were rather diverse and the composition dissimilar between incubations with saturated- and unsaturated-LCFA. Stearate-degrading communities were enriched in Deltaproteobacteria (34% of the assigned sequences), while microorganisms clustering within the Synergistia class were more predominant in oleate incubation (25% of the assigned sequences). Bacterial communities were diverse and active, given by the high percentage of proteins related with mechanisms of energy production. Several proteins were assigned to syntrophic bacteria, emphasizing the importance of the interactions between acetogens and methanogens in energy exchange and formation in anaerobic LCFA-rich environments.
2024-05-03 | PXD047715 | Pride
Project description:A combination of shotgun metaproteomics and 16S rRNA gene pyrosequencing wasused to identify potential functional pathways and key microorganisms involved in long-chain fatty acids (LCFA) anaerobic conversion. Microbial communities degrading saturated- and unsaturated-LCFA were compared. Archaeal communities were mainly composed of Methanosaeta, Methanobacterium and Methanospirillum species, both in stearate (saturated C18:0) and oleate (mono-unsaturated C18:1) incubations. Over 80% of the 16S rRNA gene sequences clustered within the Methanosaeta genus, which is in agreement with the high number of proteins assigned to this group (94%). Archaeal proteins related with methane metabolism were highly expressed. Bacterial communities were rather diverse and the composition dissimilar between incubations with saturated- and unsaturated-LCFA. Stearate-degrading communities were enriched in Deltaproteobacteria (34% of the assigned sequences), while microorganisms clustering within the Synergistia class were more predominant in oleate incubation (25% of the assigned sequences). Bacterial communities were diverse and active, given by the high percentage of proteins related with mechanisms of energy production. Several proteins were assigned to syntrophic bacteria, emphasizing the importance of the interactions between acetogens and methanogens in energy exchange and formation in anaerobic LCFA-rich environments.
2024-05-03 | PXD047711 | Pride
Project description:Mitochondrial rRNAs play important roles in regulating mtDNA-encoded gene expression and energy metabolism subsequently. However, the proteins that regulate mitochondrial 16S rRNA processing remain poorly understood. Herein, we generated adipose-specific Wbscr16-/- mice and cells, both of which exhibited dramatic mitochondrial changes. Subsequently, WBSCR16 was identified as a 16S rRNA-binding protein essential for the cleavage of 16S rRNA-mt-tRNALeu, facilitating 16S rRNA processing and mitochondrial ribosome assembly. Additionally, WBSCR16 recruited RNase P subunit MRPP3 to nascent 16S rRNA and assisted in this specific cleavage. Furthermore, evidence showed that adipose-specific Wbscr16 ablation promotes energy wasting via lipid preference in brown adipose tissue, leading to excess energy expenditure and resistance to obesity. In contrast, overexpression of WBSCR16 upregulated 16S rRNA processing and induced a preference for glucose utilization in both transgenic mouse models and cultured cells. These findings suggest that WBSCR16 plays essential roles in mitochondrial 16S rRNA processing in mammals, and is the key mitochondrial protein to balance glucose and lipid metabolism.
2024-12-30 | GSE229693 | GEO
Project description:16S rRNA gene sequencing of colonic feces from mice fed regular chow, regular chow+nobiletin, high-fat diet or high-fat diet+nobiletin.
2022-05-06 | E-MTAB-11551 | biostudies-arrayexpress
Project description:We report the use of high-throughput sequencing technology to detect the microbial composition and abundance of mice grastic contents before and after Helicobacter pylori infection or Lactobacillus paracasei ZFM54 pretreatment/treatment. The genomic DNA was obtained by the QIAamp PowerFecal DNA Kit. Then, the DNA samples were sent to BGI Genomics Co., Ltd. (Shenzhen, China) for V3-V4 region of the 16S rRNA gene high-throughput sequencing with an Illumina MiSeq platform. DNA samples were sequenced using primers 338F (forward primer sequence ACTCCTACGGGAGGCAGCAG)-806R (reverse primer sequence GGACTACHVGGGTWTCTAAT). The sequencing analyses were carried out using silva138/16s database as a reference for the assignation of Amplicon Sequence Variant (ASV) at 100% similarity.
2022-07-27 | GSE208665 | GEO
Project description:Here we report 16s rRNA data in gut microbiota of hepatocellular carcinoma (HCC) patients with HBV induced HCC (HBVC) and non-HBV induced HCC (NHBVC) compared with healthy volunteers. A total of 2047 operational taxonomic units (OTUs) were identified in the sequence data. Our data shows that the NHBVC patients harbor lower anti-inflammatory bacteria and more pro-inflammatory bacteria, while the HBVC patients harbor more anti-inflammatory bacteria.
2019-02-27 | GSE108847 | GEO
Project description:Ribosomes of Bacteroidia (formerly Bacteroidetes) fail to recognize Shine-Dalgarno (SD) sequences even though they harbor the anti-SD (ASD) of 16S rRNA. This is due to sequestration of the 3’ tail of 16S rRNA in a pocket formed by bS21, bS18, and bS6 on the 30S platform, which functionally occludes the ASD. Interestingly, in many Flavobacteriales, the gene encoding bS21, rpsU, contains an extended SD sequence. In this work, we present genetic and biochemical evidence that bS21 synthesis in Flavobacterium johnsoniae is autoregulated via a subpopulation of ribosomes that specifically lack bS21. Mutation or depletion of bS21 in the cell specifically increases translation of reporters with strong SD sequences, such as rpsU’-gfp. Purified ribosomes lacking bS21 (or its C-terminal region) exhibit higher rates of initiation on rpsU mRNA and lower rates of initiation on other (SD-less) mRNAs than control ribosomes. The mechanism of autoregulation depends on extensive pairing between mRNA and 16S rRNA, and exceptionally strong SD sequences, with predicted pairing free energies of < –13 kcal/mol, are characteristic of rpsU across the Bacteroidia. To our knowledge, this is the first example of biochemically-verified specialized ribosomes with a clear regulatory purpose.
2023-03-11 | PXD036353 | Pride