Browse
Submit Data
Databases
API
Help

Dataset Information

0 Views

0 Connections

0 Citations

0 Reanalyses

0 Downloads

Omics score: 0

Hhigh-throughput sequencing of in vitro fecal fermentation samples

ABSTRACT: Hhigh-throughput sequencing of in vitro fecal fermentation samples

PROVIDER: PRJNA860582 | ENA |

REPOSITORIES: ENA

ACCESS DATA

Json Xml

Dataset's files

Source:

			Action	DRS
	SRR20327000_1.fastq.gz	Fastqsanger.gz
	SRR20327000_2.fastq.gz	Fastqsanger.gz
	SRR20327001_1.fastq.gz	Fastqsanger.gz
	SRR20327001_2.fastq.gz	Fastqsanger.gz
	SRR20327002_1.fastq.gz	Fastqsanger.gz

Items per page:

1 - 5 of 96

Similar Datasets

High-throughput sequencing of in vitro fecal fermentation samples

Project description:High-throughput sequencing of in vitro fecal fermentation samples

| PRJNA821446 | ENA

High-throughput sequencing of in vitro fecal fermentation samples

Project description:We report the use of high-throughput sequencing technology to detect the microbial composition and abundance of human feces after in vitro co-fermentation with citrus peel flavonoid extracts. The genomic DNA was obtained by the QIAamp PowerFecal DNA Kit. Then, the DNA samples were sent to Biomarker Bio-Tech (Beijing, China) for V3-V4 region of the 16S rDNA gene high-throughput sequencing with an Illumina MiSeq platform. DNA samples were sequenced using primers 338F (forward primer sequence ACTCCTACGGGAGGCAGCAG)-806R (reverse primer sequence GGACTACHVGGGTWTCTAAT). A total of 8,816,250 pairs of Reads were obtained from the 112 samples sequenced, and 8,721,112 Clean Reads were generated from the double-ended Reads after quality control and splicing. The sequencing analyses were carried out using the SILVA database as a reference for the assignation of operational taxonomic units (OTUs) with 97% of identity.

2022-04-02 | GSE199749 | GEO

Hhigh-throughput sequencing of in vitro fecal fermentation samples

Project description:We report the use of high-throughput sequencing technology to detect the microbial composition and abundance of mice grastic contents before and after Helicobacter pylori infection or Lactobacillus paracasei ZFM54 pretreatment/treatment. The genomic DNA was obtained by the QIAamp PowerFecal DNA Kit. Then, the DNA samples were sent to BGI Genomics Co., Ltd. (Shenzhen, China) for V3-V4 region of the 16S rRNA gene high-throughput sequencing with an Illumina MiSeq platform. DNA samples were sequenced using primers 338F (forward primer sequence ACTCCTACGGGAGGCAGCAG)-806R (reverse primer sequence GGACTACHVGGGTWTCTAAT). The sequencing analyses were carried out using silva138/16s database as a reference for the assignation of Amplicon Sequence Variant (ASV) at 100% similarity.

2022-07-27 | GSE208665 | GEO

In vitro fecal fermentation of dried chicory root

Project description:In vitro assessment of dried chicory root fermentation by the fecal human microbiota

| PRJEB74436 | ENA

Fermentation samples

Project description:Fermentation samples Metagenome

| PRJNA801694 | ENA

Fecal samples

Project description:Fecal samples Metagenome

| PRJNA730197 | ENA

Fermentation samples

Project description:Fermentation samples Raw sequence reads