Browse
Submit Data
Databases
API
Help

Dataset Information

0 Views

0 Connections

0 Citations

0 Reanalyses

0 Downloads

Omics score: 0

High-throughput sequencing of in vitro fecal fermentation samples

ABSTRACT: High-throughput sequencing of in vitro fecal fermentation samples

PROVIDER: PRJNA821446 | ENA |

REPOSITORIES: ENA

ACCESS DATA

Json Xml

Dataset's files

Source:

			Action	DRS
	SRR18533800_1.fastq.gz	Fastqsanger.gz
	SRR18533800_2.fastq.gz	Fastqsanger.gz
	SRR18533801_1.fastq.gz	Fastqsanger.gz
	SRR18533801_2.fastq.gz	Fastqsanger.gz
	SRR18533802_1.fastq.gz	Fastqsanger.gz

Items per page:

1 - 5 of 224

Similar Datasets

High-throughput sequencing of in vitro fecal fermentation samples

Project description:We report the use of high-throughput sequencing technology to detect the microbial composition and abundance of human feces after in vitro co-fermentation with citrus peel flavonoid extracts. The genomic DNA was obtained by the QIAamp PowerFecal DNA Kit. Then, the DNA samples were sent to Biomarker Bio-Tech (Beijing, China) for V3-V4 region of the 16S rDNA gene high-throughput sequencing with an Illumina MiSeq platform. DNA samples were sequenced using primers 338F (forward primer sequence ACTCCTACGGGAGGCAGCAG)-806R (reverse primer sequence GGACTACHVGGGTWTCTAAT). A total of 8,816,250 pairs of Reads were obtained from the 112 samples sequenced, and 8,721,112 Clean Reads were generated from the double-ended Reads after quality control and splicing. The sequencing analyses were carried out using the SILVA database as a reference for the assignation of operational taxonomic units (OTUs) with 97% of identity.

2022-04-02 | GSE199749 | GEO

Hhigh-throughput sequencing of in vitro fecal fermentation samples

Project description:Hhigh-throughput sequencing of in vitro fecal fermentation samples

| PRJNA860582 | ENA

Hhigh-throughput sequencing of in vitro fecal fermentation samples

Project description:We report the use of high-throughput sequencing technology to detect the microbial composition and abundance of mice grastic contents before and after Helicobacter pylori infection or Lactobacillus paracasei ZFM54 pretreatment/treatment. The genomic DNA was obtained by the QIAamp PowerFecal DNA Kit. Then, the DNA samples were sent to BGI Genomics Co., Ltd. (Shenzhen, China) for V3-V4 region of the 16S rRNA gene high-throughput sequencing with an Illumina MiSeq platform. DNA samples were sequenced using primers 338F (forward primer sequence ACTCCTACGGGAGGCAGCAG)-806R (reverse primer sequence GGACTACHVGGGTWTCTAAT). The sequencing analyses were carried out using silva138/16s database as a reference for the assignation of Amplicon Sequence Variant (ASV) at 100% similarity.

2022-07-27 | GSE208665 | GEO

In vitro fecal fermentation of dried chicory root

Project description:In vitro assessment of dried chicory root fermentation by the fecal human microbiota

| PRJEB74436 | ENA

Benchmarking low- and high-throughput protein cleanup and digestion methods for human fecal metaproteomics

Project description:Benchmarking low- and high-throughput protein cleanup and digestion methods for human fecal metaproteomics

2024-05-31 | PXD049294 | Pride

Faecal fermentation samples

Project description:In vitro fermentation of Astragalus polysaccharide

| PRJNA650589 | ENA

In vitro fecal fermentation of dried chicory root

Project description:Changes in the fecal microbial community following in vitro fermentation of dried chicory root particles to produce fermentation supernatants for an ex vivo gut barrier integrity model

| PRJEB74437 | ENA

Human Fecal Metagenomic Samples

Project description:OLIPOP-grown Human Fecal Fermentation Consortia

| PRJNA950354 | ENA

in vitro rumen fermentation

Project description:in vitro rumen fermentation Raw sequence reads

| PRJNA1143416 | ENA

in vitro rumen fermentation

Project description:in vitro rumen fermentation Raw sequence reads

| PRJNA1175582 | ENA