Browse
Submit Data
Databases
API
Help

Dataset Information

0 Views

0 Connections

0 Citations

0 Reanalyses

0 Downloads

Omics score: 0

ABSTRACT: 16S rRNA gene V4 region amplicon sequencing of nasal lavage specimens from healthy and sick children

PROVIDER: PRJNA866994 | ENA |

REPOSITORIES: ENA

ACCESS DATA

Json Xml

Dataset's files

Source:

			Action	DRS
	SRR21019238_1.fastq.gz	Fastqsanger.gz
	SRR21019238_2.fastq.gz	Fastqsanger.gz
	SRR21019239_1.fastq.gz	Fastqsanger.gz
	SRR21019239_2.fastq.gz	Fastqsanger.gz
	SRR21019240_1.fastq.gz	Fastqsanger.gz

Items per page:

1 - 5 of 42

Similar Datasets

The rhinobiome of exacerbated preschool wheezers & asthmatics: insights from a German pediatric exacerbation network

Project description:Although the nose, as a gateway for organism-environment interactions, may have a key role in asthmatic exacerbation, the rhinobiome of exacerbated children with asthma was widely neglected to date. Deep nasopharyngeal swab specimens, nasal epithelial spheroid cultures (NAEsp), and blood samples of acute exacerbated wheezers (WH), asthmatics (AB), and healthy controls (HC) were used for culture (n=146), 16 S-rRNA gene amplicon sequencing (n=64), proteomic and cytokine analyses. Interestingly, Proteobacteria were over-represented in WH (WH to AB: p=0.005; WH to HC: p=0.021), whereas Firmicutes and Bacterioidetes were associated with AB. In contrast, Actinobacteria commonly colonized HCs (PermANOVA p=0.005). Moreover, Staphylococcaceae (p<0.05), Enterobacteriaceae (p<0.05), Burkholderiaceae (p<0.05), Xanthobacteraceae (p<0.05), and Sphingomonadaceae (p<0.05) were significantly more abundant in AB compared to WH and HC. The α‐diversity analyses demonstrated an increase of bacterial abundance levels in atopic AB and a decrease in WH samples. Microbiome profiles of atopic WH differed significantly from atopic AB. The NAEsp bacterial exposure with M. catarrhalis, S. aureus and H. influenzae experiments provided a disrupted epithelial cell integrity, a cytokine release and cohort specific proteomic differences especially for M. catarrhalis cultures. Our comprehensive dataset contributes to a deeper insight into the poorly understood plasticity of the nasal microbiota, and, in particular, may enforce our understanding in the pathogenesis of asthma exacerbation in childhood.

2021-05-27 | PXD024694 | Pride

Analysis of microbiota composition within breast tumor and healthy breast tissues in males and females

Project description:Total DNA was extracted from FFPE specimens of breast tumor and surrounding healthy tissue, amplified to collect amplicons of variable V3–V4 regions of the bacterial 16s rRNA gene and sequenced with MiSeq (2x300bp) Illumina platform.

2023-06-14 | GSE212891 | GEO

human nasopharyngeal metagenome

Project description:16S rRNA gene sequencing of nasal lavage in asthma children

| PRJNA292612 | ENA

Multiomic Approach to Analyze Infant Gut Microbiota: Experimental and Analytical Method Optimization

Project description:BACKGROUND: The human intestinal microbiome plays a central role in overall health status, especially in early life stages. 16S rRNA amplicon sequencing is used to profile its taxonomic composition; however, multiomic approaches have been proposed as the most accurate methods for study of the complexity of the gut microbiota. In this study, we propose an optimized method for bacterial diversity analysis that we validated and complemented with metabolomics by analyzing fecal samples.METHODS: Forty-eight different analytical combinations regarding (1) 16S rRNA variable region sequencing, (2) a feature selection approach, and (3) taxonomy assignment methods were tested. A total of 18 infant fecal samples grouped depending on the type of feeding were analyzed by the proposed 16S rRNA workflow and by metabolomic analysis.RESULTS: The results showed that the sole use of V4 region sequencing with ASV identification and VSEARCH for taxonomy assignment produced the most accurate results. The application of this workflow showed clear differences between fecal samples according to the type of feeding, which correlated with changes in the fecal metabolic profile.CONCLUSION: A multiomic approach using real fecal samples from 18 infants with different types of feeding demonstrated the effectiveness of the proposed 16S rRNA-amplicon sequencing workflow.

2021-08-18 | MTBLS2942 | MetaboLights

Evaluating the gut microbiota shifts caused by two diets based on ancient grains

Project description:Total DNA was extracted from stool specimens, amplified to collect amplicons of variable V3–V4 regions of the bacterial 16s rRNA gene and sequenced with MiSeq (2x300bp) Illumina platform.

2022-08-24 | GSE206807 | GEO

Virus-induced inflammatory gene networks underlying asthma exacerbations in vivo

Project description:Global patterns of gene expression was profiled in nasal lavage samples obtained from asthmatic children during an acute Picornavirus-induced exacerbation and 7-14 days later. Gene coexpression network analysis and prior knowledge was employed to reconstruct the wiring diagram of the underlying gene networks. The study design consisted of paired samples obtained during the acute exacerbation and 7-14 days later from 16 asthmatic children.

2011-12-11 | E-GEOD-30326 | biostudies-arrayexpress

Virus-induced inflammatory gene networks underlying asthma exacerbations in vivo

2011-12-11 | GSE30326 | GEO

Project description:Microbial eukaryotic 18S v4 region amplicon

| PRJNA646537 | ENA

Hhigh-throughput sequencing of in vitro fecal fermentation samples

Project description:We report the use of high-throughput sequencing technology to detect the microbial composition and abundance of mice grastic contents before and after Helicobacter pylori infection or Lactobacillus paracasei ZFM54 pretreatment/treatment. The genomic DNA was obtained by the QIAamp PowerFecal DNA Kit. Then, the DNA samples were sent to BGI Genomics Co., Ltd. (Shenzhen, China) for V3-V4 region of the 16S rRNA gene high-throughput sequencing with an Illumina MiSeq platform. DNA samples were sequenced using primers 338F (forward primer sequence ACTCCTACGGGAGGCAGCAG)-806R (reverse primer sequence GGACTACHVGGGTWTCTAAT). The sequencing analyses were carried out using silva138/16s database as a reference for the assignation of Amplicon Sequence Variant (ASV) at 100% similarity.

2022-07-27 | GSE208665 | GEO

LC-MS/MS of autotrophic culture BP, that performs nitrate reduction coupled to iron(II) oxidation (NDFO)

Project description:Nitrate-reducing iron(II)-oxidizing (NDFO) bacteria are widespread in the environment contribute to nitrate removal and influence the fate of the greenhouse gases nitrous oxide and carbon dioxide. The autotrophic growth of nitrate-reducing iron(II)-oxidizing bacteria is rarely investigated and poorly understood. The most prominent model system for this type of studies is enrichment culture KS, which originates from a freshwater sediment in Bremen, Germany. A second NDFO culture, culture BP, was obtained with a sample taken in 2015 at the same pond and cultured in a similar way. To gain insights in the metabolism of nitrate reduction coupled to iron(II) oxidation under in the absence of organic carbon and oxygen limited conditions, we performed metagenomic, metatranscriptomic and metaproteomic analyses of culture BP. Raw sequencing data of 16S rRNA amplicon sequencing (V4 region with Illumina and near full-length with PacBio), shotgun metagenomics, metagenome assembly, raw sequencing data of shotgun metatranscriptomes (2 conditions, triplicates) can be found at SRA in https://www.ncbi.nlm.nih.gov/bioproject/PRJNA693457. This dataset contains proteomics data for 2 conditions in triplicates. Samples R23, R24, and R25 are grown in autotrophic conditions, samples R26, R27, and R28 in heterotrophic conditions.

2021-05-17 | PXD023710 | Pride

OmicsDI is part of the ELIXIR infrastructure

OmicsDI is an Elixir interoperability service. Learn more ›

Tweets

OmicsDI Databases

PRIDE
PeptideAtlas
MassIVE
JPOST Repository
Physiome Model Repository

EGA
EVA
ENA
LINCS
PAXDB
Cell Collective

MetaboLights
Metabolomics Workbench
MetabolomeExpress
GNPS
BioModels
FAIRDOMHub

ArrayExpress
dbGaP
ExpressionAtlas
GEO
NODE

Information

Databases
Help
API
Contact us
Code on GitHub
Terms of use
Submit Data