Browse
Submit Data
Databases
API
Help

Dataset Information

0 Views

0 Connections

0 Citations

0 Reanalyses

0 Downloads

Omics score: 0

In vitro fermentation solution

ABSTRACT: In vitro fermentation solution Genome sequencing and assembly

PROVIDER: PRJNA987521 | ENA |

REPOSITORIES: ENA

ACCESS DATA

Json Xml

Dataset's files

Source:

			Action	DRS
	SRR25058000_1.fastq.gz	Fastqsanger.gz
	SRR25058000_2.fastq.gz	Fastqsanger.gz
	SRR25058001.fastq.gz	Fastqsanger.gz
	SRR25058001_1.fastq.gz	Fastqsanger.gz
	SRR25058001_2.fastq.gz	Fastqsanger.gz

Items per page:

1 - 5 of 94

Similar Datasets

in vitro rumen fermentation

Project description:in vitro rumen fermentation Raw sequence reads

| PRJNA1143416 | ENA

in vitro rumen fermentation

Project description:in vitro rumen fermentation Raw sequence reads

| PRJNA1175582 | ENA

In vitro rumen fermentation

Project description:In vitro rumen fermentation Raw sequence reads

| PRJNA560091 | ENA

dissolved black carbon solution

Project description:dissolved black carbon solution Genome sequencing and assembly

| PRJNA813032 | ENA

In vitro batch fermentation by-products

Project description:In vitro batch fermentation by-products

| PRJEB38263 | ENA

In vitro fermentation with rumen fluid

Project description:In vitro fermentation with rumen fluid

| PRJNA940661 | ENA

ruminal liquid in vitro fermentation cultures

Project description:ruminal liquid in vitro fermentation cultures Metagenome

| PRJNA1085643 | ENA

High-throughput sequencing of in vitro fecal fermentation samples

Project description:We report the use of high-throughput sequencing technology to detect the microbial composition and abundance of human feces after in vitro co-fermentation with citrus peel flavonoid extracts. The genomic DNA was obtained by the QIAamp PowerFecal DNA Kit. Then, the DNA samples were sent to Biomarker Bio-Tech (Beijing, China) for V3-V4 region of the 16S rDNA gene high-throughput sequencing with an Illumina MiSeq platform. DNA samples were sequenced using primers 338F (forward primer sequence ACTCCTACGGGAGGCAGCAG)-806R (reverse primer sequence GGACTACHVGGGTWTCTAAT). A total of 8,816,250 pairs of Reads were obtained from the 112 samples sequenced, and 8,721,112 Clean Reads were generated from the double-ended Reads after quality control and splicing. The sequencing analyses were carried out using the SILVA database as a reference for the assignation of operational taxonomic units (OTUs) with 97% of identity.

2022-04-02 | GSE199749 | GEO

In vitro polyphenol fermentation.

Project description:In vitro fermentation of gut bacteria with polyphenols adsorbed to apple cell walls.

| PRJEB33502 | ENA

Fermentation metagenome

Project description:In vitro Fermentation Metagenome

| PRJNA573727 | ENA