Browse
Submit Data
Databases
API
Help

Unknown,Transcriptomics,Genomics,Proteomics

Dataset Information

48 Views

0 Connections

0 Citations

0 Reanalyses

0 Downloads

Omics score: 0

Profiling of Argonaute (AGO) 2-associated sRNAs after infection of bacterial pathogen Pseudomonas syringae

ABSTRACT: Transgenic Arabidopsis plants (AGO2::HA:AGO2) were treated with either mock (10 mM MgCl2) or Pseudomonas syringae pv. tomato (Pst) expressing avrRpt2 (R2) at a concentration of 2 x 107 cfu/ml for 14 hours. sRNAs associated with AGO1 and AGO2 were co-immunoprecipitated using antibodies against either AGO1 (AGO1-IP), or HA (hemagglutinin) (AGO2-IP). As controls, we also gel-purified the 18-28 nt fraction of the total RNAs from an AGO2 mutant (ago2-1). The co-immunoprecipitated or gel-purified RNAs were cloned and sequenced by Illumina deep sequencing. Examination of AGO-associated sRNAs in pathogen-treated or control plants

ORGANISM(S): Arabidopsis thaliana

SUBMITTER: Wei-Chi Wang

PROVIDER: E-GEOD-26161 | biostudies-arrayexpress |

REPOSITORIES: biostudies-arrayexpress

ACCESS DATA

Json Xml

Publications

Arabidopsis Argonaute 2 regulates innate immunity via miRNA393(∗)-mediated silencing of a Golgi-localized SNARE gene, MEMB12.

Zhang Xiaoming X Zhao Hongwei H Gao Shang S Wang Wei-Chi WC Katiyar-Agarwal Surekha S Huang Hsien-Da HD Raikhel Natasha N Jin Hailing H

Molecular cell 20110501 3

Argonaute (AGO) proteins are critical components of RNA silencing pathways that bind small RNAs and mediate gene silencing at their target sites. We found that Arabidopsis AGO2 is highly induced by the bacterial pathogen Pseudomonas syringae pv. tomato (Pst). Further genetic analysis demonstrated that AGO2 functions in antibacterial immunity. One abundant species of AGO2-bound small RNA is miR393b(∗), which targets a Golgi-localized SNARE gene, MEMB12. Pst infection downregulates MEMB12 in a miR ...[more]

PMID: 21549312

Similar Datasets

Virus infection triggers widespread silencing of host genes by a distinct class of endogenous siRNAs in Arabidopsis

Project description:Virus infection triggers widespread silencing of host genes by a distinct class of endogenous siRNAs in Arabidopsis This study constructed and sequenced two independent small RNA libraries from the upper uninoculated leaves of (i) WT Arabidopsis plants 14 d after mock inoculation and of (ii) rdr1 rdr6 plants 14 d after infection with Fny CMV-Δ2b, and one library each from the upper uninoculated leaves of (iii) WT, (iv) rdr1, and (v) rdr6 plants 14 d after infection with TuMV-GFP. Coimmunoprecipitation with FLAG- and HA-specific antibodies was used to obtain (vi,vii) AGO1 and (viii,ix) AGO2 complexes, respectively, from the FLAG-AGO1/ago1-36 and HA-AGO2 plants 14 d after infection with Fny CMV-Δ2b for extracting total loaded small RNAs for the construction and sequencing of small RNA libraries.

2014-08-30 | E-GEOD-60929 | biostudies-arrayexpress

Profiling of Argonaute (AGO) 2-associated sRNAs after infection of bacterial pathogen Pseudomonas syringae

Project description:Transgenic Arabidopsis plants (AGO2::HA:AGO2) were treated with either mock (10 mM MgCl2) or Pseudomonas syringae pv. tomato (Pst) expressing avrRpt2 (R2) at a concentration of 2 x 107 cfu/ml for 14 hours. sRNAs associated with AGO1 and AGO2 were co-immunoprecipitated using antibodies against either AGO1 (AGO1-IP), or HA (hemagglutinin) (AGO2-IP). As controls, we also gel-purified the 18-28 nt fraction of the total RNAs from an AGO2 mutant (ago2-1). The co-immunoprecipitated or gel-purified RNAs were cloned and sequenced by Illumina deep sequencing.

2011-05-10 | GSE26161 | GEO

Global identification of Arabidopsis thaliana ARGONAUTE1-associated small RNA.

Project description:Small RNA from total RNA (input fraction) and immunoprecipitated HA-AGO1-complexes (IP fraction) were identified using high-throughput sequencing-by-synthesis. Two replicate input fraction samples were used as controls for two replicate IP fraction samples. Total RNA from input fractions and small RNA that co-immunoprecipitated with HA-AGO1 complexes were size fractionated by polyacrylamide gel electrophoresis to recover 18-24 nucleotide small RNA. 3' and then 5' adaptors were serially ligated on to each small RNA followed by PAGE purification. RT-PCR was used to convert RNA to DNA amplicons. Amplicons were sequenced using the Illumina GAIIx platform. Resulting reads were parsed and mapped to the A. thaliana genome (TAIR9) using the CASHX pipeline.

2010-06-21 | E-GEOD-22252 | biostudies-arrayexpress

Ago1 vs Ago2-IP small RNA deep-sequencing with age in Drosophila

Project description:Drosophila miRNAs show distinct change in isoform distribution pattern with age. Some miRNAs show accumulation of the short isoforms, while other miRNAs show the accumulation of the long isoforms with age. The increase of the long isoforms of some miRNAs reflects increased 2'-O-methylated miRNA isoforms with age. The increase in 2'-O-methylated miRNA isoforms reflected increased Ago2-loading, but not Ago1-loading of specific miRNA isoforms with age. This raised a question on whether there is global shift in small RNA loading pattern between Ago1 and Ago2 with age. To investigate change in small RNA loading pattern between Ago1 and Ago2 with age, we performed small RNA deep-sequencing of Ago1 vs Ago2-IP small RNAs at 3d and 30d in Drosophila. This analysis revealed global increase of miRNA loading into Ago2, but not into Ago1 with age. 3d and 30d FLAG-HA-Ago2 male flies were collected. Ago1 and Ago2 were immunoprecipitated by anti-Ago1 and anti-FLAG M2 beads respectively. RNA was purified from the beads, P32-labeled, and small RNA fraction was gel-purififed. Small RNA libraries were prepared using Illumina's TruSeq small RNA sample preparation kit (#RS-200-0012, Illumina, Inc. San Diego, CA), following the manufacturer's protocol. The libraries were multiplexed and sequenced on HiSeq2000 platform (Illumina).

2014-01-01 | E-GEOD-52961 | biostudies-arrayexpress

Roles and Programming of Arabidopsis ARGONAUTE Proteins During Turnip Mosaic Virus Infection

Project description:AGO protein immunoprecipitation was combined with high-throughput sequencing of associated small RNAs. AGO2, AGO10, and to a lesser extent AGO1 were shown to associate with siRNAs derived from silencing suppressor (HC-Pro)-deficient TuMV-AS9, but not with siRNAs derived from wild-type TuMV. Co-immunoprecipitation and small RNA sequencing revealed that viral siRNAs broadly associated with wild-type HC-Pro during TuMV infection. These results support the hypothesis that suppression of antiviral silencing during TuMV infection, at least in part, occurs through sequestration of virus-derived siRNAs away from antiviral AGO proteins by HC-Pro. Catalytic mutant HA-AGO1-DAH, HA-AGO2-DAD and HA-AGO10-DAH or catalytically active HA-AGO10-DDH were immunoprecipitated from buffer (mock) or inoculated rosette leaves (at 7 dpi) or noninoculated cauline leaves at 10 dpi with wt TuMV or suppressor-deficient TuMV-AS9. Inflorescence from TuMV infected plants was collected at 10 dpi with wt TuMV. HC-Pro was tagged with 6xHIS in TuMV-HIS and suppressor-deficient TuMV-HIS-AS9. HC-Pro was immunoprecipitated from noninoculated cauline leaves of inflorescence at 10 dpi. HC-Pro AS9 was immunoprecipitated from noninoculated cauline leaves at 15 dpi. Total RNA was extracted from input fraction and small RNAs separated by size fractionation. Small RNAs in input and HA-AGO or HC-Pro immunoprecipitation fractions were converted to DNA Amplicons by 5' (GUUCAGAGUUCUACAGUCCGACGAUC) or 3’ (CTGTAGGCACCATCAAT) adaptor ligation followed by RT-PCR. DNA Amplicons were sequenced using the Illumina HiSeq2000 platform. Duplicate libraries were made per treatment. For each library, hits to TuMV, to TuMV-HIS and to Arabidopsis thaliana were included in separate files.

2015-04-06 | E-GEOD-64911 | biostudies-arrayexpress

ChIP-seq of Arabidopsis ARGONAUTE-small RNA interactions in Arabidopsis thaliana identified by high-throughput sequencing

Project description:The goal of this study was to identify small RNA-ARGONAUTE interactions in Arabidopsis. Co-immunoprecipitation assays followed by high-throughput sequencing were done to identify small RNA associated with HA-AGO2 and HA-AGO7. Experiment Overall Design: Sequencing-by-synthesis technology was used to sequence small RNA from input and co-immunoprecipitation fractions from cell lysates of inflorescence tissue from Arabidopsis plants transformed with HA epitope-tagged AGO2 or AGO7 constructs. Meaningful intepretation requires comparison between the input and co-immunoprecipitation datasets. Experiment Overall Design: Note: Raw data files requested, however, the submitter declined to provide them.

2009-08-30 | E-GEOD-12037 | biostudies-arrayexpress

LIS1 RNA binding orchestartes the mechanosensitive properties of embryonic stem cells in AGO2 dependent and independent ways.

Project description:LIS1 immunoprecipitation in nuclear and cytoplasmic fractions of LIS1 Floxed/-, OE and WT embryonic stem cells. To identify AGO2 dependent and independent interactions LIS1 was immunoprecipitated in AGO1-4 knockout and doxycycline induced AGO2 mouse embryonic stem cells.

2023-07-20 | PXD033150 | Pride

miRNAs associated with the different human Argonaute proteins

Project description:microRNAs (miRNAs) are small non-coding RNAs that function in literally all cellular processes. miRNAs interact with Argonaute (Ago) proteins and guide them to specific target sites located in the 3’ untranslated region (UTR) of target mRNAs leading to translational repression and deadenylation-induced mRNA degradation. Most miRNAs are processed from hairpin-structured precursors by the consecutive action of the RNase III enzymes Drosha and Dicer. However, processing of miR-451 is Dicer-independent and cleavage is mediated by the endonuclease Ago2. Here we have characterized miR-451 sequence and structure requirements for processing as well as sorting of miRNAs into different Ago proteins. Pre-miR-451 appears to be optimized for Ago2 cleavage and changes result in reduced processing. In addition, we show that the mature miR-451 only associates with Ago2 suggesting that mature miRNAs are not exchanged between different members of the Ago protein family. Based on cloning and deep sequencing of endogenous miRNAs associated with Ago1-3, we do not find evidence for miRNA sorting in human cells. However, Ago identity appears to influence the length of some miRNAs, while others remain unaffected. Examination of miRNAs associated with endogenous human Ago1-4 in HeLa cells

2013-03-29 | E-GEOD-45506 | biostudies-arrayexpress

RNAi knock down of four Argonaute paralogs (AGO1, AGO2, PIWI and Aubergine) and the microRNA-processing enzyme Drosha in Drosophila

Project description:RNA silencing pathways are conserved gene regulation mechanisms that lead to degradation, translational repression or transcriptional silencing of target-transcripts selected based on complementarity with small RNA molecules. The fraction of the genome regulated by these pathways has not been established. Argonaute proteins play fundamental roles in RNA silencing. To identify their physiological targets at the genomic level, we examined expression profiles in Drosophila cells depleted of 4 Argonaute paralogs (i.e. AGO1, AGO2, PIWI or Aubergine). We also profiled cells depleted of the microRNA (miRNA)-processing enzyme Drosha.

2006-11-20 | E-MEXP-295 | biostudies-arrayexpress

MCMV infection of cultured mouse cells induces expression of miR-7a.

Project description:One goal of viral infection is to reprogram the host cell to optimize viral replication. As part of this process, viral miRNAs may compete for components of the miRNA/siRNA pathway as well as regulate cellular targets. Mouse Cytomegalovirus has been described to generate large numbers of viral miRNAs during lytic infection and was therefore used to analyze the impact of viral miRNAs on the host cell small RNA system as well as to check for sorting of viral small RNAs into specific Ago-proteins. Deep sequencing analysis of MCMV infected cells revealed that viral miRNAs represent only app. 13% of all detected miRNAs. All previously described MCMV miRNAs with the exception of miR-m88-1* were confirmed and for the MCMV miR-m01-1 hairpin an additional miRNA, designated miR-m01-1-3p, was found. Its presence was confirmed by qPCR and Northern Blot. Deep sequencing after RISC IP with antibodies specific for either Ago1 or Ago2 showed that all MCMV miRNAs are loaded into both RISC complexes. The ratio of MCMV to mouse miRNAs was not increased after immunoprecipitation of Ago-proteins. Viral miRNAs therefore do not overwhelm the host miRNA processing system nor are they preferentially incorporated into RISC. We found that 3 mouse miRNAs showed an altered expression due to MCMV infection. Down-regulation of miR-27a, as previously described, could be confirmed. In addition, miR-26a was down-regulated and an up-regulation of miR-7a dependent on viral protein expression could be observed. Examination of small RNA expression in uninfected vs. infected cells, immunoprecipitation + sequencing of Ago1 and Ago2 loaded small RNAs in infected cells

2012-06-30 | E-GEOD-36919 | biostudies-arrayexpress

OmicsDI is part of the ELIXIR infrastructure

OmicsDI is an Elixir interoperability service. Learn more ›

Tweets

OmicsDI Databases

PRIDE
PeptideAtlas
MassIVE
JPOST Repository
Physiome Model Repository

EGA
EVA
ENA
LINCS
PAXDB
Cell Collective

MetaboLights
Metabolomics Workbench
MetabolomeExpress
GNPS
BioModels
FAIRDOMHub

ArrayExpress
dbGaP
ExpressionAtlas
GEO
NODE

Information

Databases
Help
API
Contact us
Code on GitHub
Terms of use
Submit Data