Browse
Submit Data
Databases
API
Help

Unknown,Transcriptomics,Genomics,Proteomics

Dataset Information

34 Views

0 Connections

0 Citations

0 Reanalyses

0 Downloads

Omics score: 0

Chromatin immunoprecipitation to map nucleosomes and H3 lysine 14 acetylation in two unrelated strains of yeast

ABSTRACT: Nucleosome mapping and histone H3 lysine 14 acetylation chromatin immuno-precipitation in two unrelated strains of yeast (BY and RM).

ORGANISM(S): Saccharomyces cerevisiae

SUBMITTER: jean-baptiste veyrieras

PROVIDER: E-MEXP-1777 | biostudies-arrayexpress |

REPOSITORIES: biostudies-arrayexpress

ACCESS DATA

Json Xml

Similar Datasets

GIM musmusculus anti-Dicer RNAi silencing

Project description:We used the TriFectaTM (IDT, Integrated DNA Technologies, Coralville, IA, USA) anti-Dicer RNAi sequence (AGAACGAAAUGCAAGGAAUGGACTCGAGUCCAUUCCUUGCAUUUCGUUCUUC, ACAAGAAACGGAAUCACAUCACACTAGUGUGAUGUGAUUCCGUUUCUUGUCG, GCAGUUGUCCUAAACAGAUUGAUAAUUAUCAAUCUGUUUAGGACAACUGCUG) to silencing Dicer mRNA. Confluent cultures of 3.10 mTEC cell line were transfected with 20 nM of each anti-Dicer siRNA using Hiperfect reagent (Qiagen) following manufacturerM-^Rs instructions. After transfection, cells were cultured during 24 h in RPMI medium as above mentioned and total RNA was extracted using the mirVana kit (Ambion), which served as template for cDNA synthesis. Gene knockdown was confirmed by quantitative PCR (qRT-PCR) using the primers 5M-^RCCCAAATGTAGAACCCGAGA 3M-^R forward and 5M-^RCAACCGACACTGTCCATCG 3M-^R reverse, which allowed amplification of a 119 bp PCR product corresponding to a segment of the Dicer mRNA (cDNA). Transcriptional expression levels were determined using a StepOne Real-Time PCR System (Applied Biosystems, USA).

2011-08-30 | E-MEXP-3211 | biostudies-arrayexpress

Transcription profiling by array of chicken wild type and tumor supressor Dot1L knockout lymphoblast cells

Project description:Effect of abrogation of the histone methyltransferase Dot1L on gene expression in the chicken DT40 model system

2011-05-07 | E-MEXP-2722 | biostudies-arrayexpress

Chromatin immunoprecipitation of yeast strains BY4716 and RM11-1a to detect H3K4me2 binding sites

Project description:Single-nucleosome ChIP-CHIP of H3K4me2 in two unrelated strains of S. cerevisiae (By and RM). See Nagarajan et al. paper for details.

2014-12-31 | E-MEXP-2217 | biostudies-arrayexpress

Genome-Wide STAT5 binding sites in Kit225 leukemia cells

Project description:In order to systematically map STAT5 genomic binding sites and IL-2 mediated gene expression changes we mapped STAT5 binding sites using chip-on-ChIP in IL-2 dependent Kit225 cells that were either left un-stimulated or stimulated with IL-2 for 30 minutes. Using MAT analysis we identified 1581 STAT5 binding sites. IL2-stimulated Kit225 cells ChIPed with STAT5 antibodies vs. Input

2013-03-21 | E-GEOD-40619 | biostudies-arrayexpress

Genome-wide maps of chromatin modifications in C57bl\6 mouse erythroid cells.

Project description:Regions of chromatin modified by H3K4me1 and H3K4me3 were identified in mouse erythroid cells using ChIP-seq. Chip-seq experiements were performed in C57bl\6 mouse erythroid Ter119+ cells.

2013-11-11 | E-GEOD-49455 | biostudies-arrayexpress

Genome-wide mapping of IL-2 regulated target genes and IL-2 activated STAT5 binding sites in Kit225 human leukemia cells.

Project description:This SuperSeries is composed of the SubSeries listed below. Refer to individual Series

2013-03-21 | E-GEOD-40624 | biostudies-arrayexpress

IL-2 induced gene expression changes in Kit225 human leukemia cell lines

Project description:Identify IL-2 mediated genes in Kit225 cells. IL-2 withdrawn cells were treated with IL-2 or left untreated for 3 hours and then subjected to gene expression microarray analysis.

2013-03-21 | E-GEOD-40618 | biostudies-arrayexpress

Transcription profiling of chicken Bcl6 deficient DT40 B cell line to investigate the targets of Bcl6 which is required for germinal center formation

Project description:The transcription factor Bcl6 is required for germinal center formation and deregulated expression of Bcl6 has been observed in lymphomas. To gain insight to the function of Bcl6 in terminal differentiation of B cells to plasma cells and to investigate the targets of Bcl6, we established a Bcl6 deficient DT40 B cell line.

2010-02-17 | E-MEXP-2062 | biostudies-arrayexpress

GIM mTEC Aire silencing

Project description:We used the TriFectaTM (IDT, Integrated DNA Technologies, Coralville, IA, USA) anti-Aire RNAi sequence (GGAUUCUCUUUAAGGACUACAAUCTAGAUUGUAGUCCUUAAAGAGAAUCCUC) in order to silencing Aire mRNA. Confluent cultures of 3.10 mTEC cell line were transfected with 10nM of anti-Aire siRNA using Hiperfect reagent (Qiagen, GmbH, Hilden, Germany) following manufacturerM-^Rs instructions. After transfection, cells were cultured during 24 h in RPMI medium as above mentioned and total RNA was extracted using the mirVana kitM-. (Ambion, Austin, TX, USA), which served as template for cDNA synthesis. Gene knockdown was confirmed by quantitative reverse transcription PCR (qRT-PCR) using the primers 5_-GCAACTCTGGCCTCAAAGAG-3_ forward and 5_-GGTCTGAATTCCGTTTCCAA-3_ reverse, which allowed amplification of a 120 bp PCR product corresponding to a segment of the Aire cDNA. The cDNA samples were prepared using Superscript II reverse transcriptase (Invitrogen Corporation, Carlsbad, CA, USA) enzyme, as recommended. Expression of the above mentioned genes was quantified using a 7500 Real Time PCR System (Applied Biosystems)

2011-08-31 | E-MEXP-3213 | biostudies-arrayexpress

A Sensitive, Rapid, Robust and Reproducible Workflow for Host Cell Protein Profiling in Biopharmaceutical Process Development

Project description:There is a growing industry and regulatory need to detect host cell protein (HCP) impurities in the production of protein biopharmaceuticals, as certain HCPs can impact product stability, safety, and efficacy, even at low levels.1-6 In some cases, regulatory agencies require the identification as well as the quantification of HCPs in drug products for risk assessment, and this is an active and growing topic of conversation in industry and amongst regulators. In this study, we developed a sensitive, robust, and reproducible workflow for HCP detection and quantification in the significantly shorter turnaround time than previously reported using an Evosep ONE LC system coupled to an Orbitrap Fusion Lumos mass spectrometer. Due to its fast turnaround time, this HCP workflow can be integrated into process development for the high-throughput (60 samples analyzed per day) identification of HCPs. The ability to rapidly measure HCPs and follow their clearance throughout the downstream process can be used to pinpoint sources of HCP contamination, which can be used to optimize biopharmaceutical production to minimize HCP levels. Analysis of the NIST monoclonal antibody (mAb) reference material using the rapid HCP profiling workflow detected the largest number of HCPs reported to date, underscoring an improvement in performance along with an increased throughput. The HCP workflow can be readily implemented and adapted for different purposes to guide biopharmaceutical process development and enable better risk assessment of HCPs in drug substances (DS) and drug products (DP).

2020-06-02 | PXD018427 | Pride

OmicsDI is part of the ELIXIR infrastructure

OmicsDI is an Elixir interoperability service. Learn more ›

Tweets

OmicsDI Databases

PRIDE
PeptideAtlas
MassIVE
JPOST Repository
Physiome Model Repository

EGA
EVA
ENA
LINCS
PAXDB
Cell Collective

MetaboLights
Metabolomics Workbench
MetabolomeExpress
GNPS
BioModels
FAIRDOMHub

ArrayExpress
dbGaP
ExpressionAtlas
GEO
NODE

Information

Databases
Help
API
Contact us
Code on GitHub
Terms of use
Submit Data