Dataset Information

Gut microbiota-derived metabolites associate with circulating immune cell subsets in unexplained recurrent spontaneous abortion.

ABSTRACT: Currently, the precise causes of over 40 % of recurrent spontaneous abortion (RSA) cases cannot be identified, leading to the term "unexplained RSA" (URSA). Through an exploration of the gut microbiota, metabolites, and immune cell subsets in URSA, this study establishes a link between gut microbiota-derived metabolites and immune cells. The results indicate reduced diversity in the gut microbiota of URSA. Targeted metabolomic analyses reveal decreased levels of gut microbiota-derived deoxycholic acid (DCA), glycolithocholic acid (GLCA), acetate, propionate, and butyrate in URSA. Furthermore, elevated frequencies of Th1, Th17, and plasma B cells, along with decreased frequencies of Tregs and Bregs, are observed in the peripheral blood of URSA. The results demonstrate correlations between the levels of gut microbiota-derived bile acids and short-chain fatty acids and the frequencies of various immune cell subsets in circulation. Collectively, this study uncovers an association between gut microbiota-derived metabolites and circulating immune cell subsets in URSA.

SUBMITTER: Li Z

PROVIDER: S-EPMC10835175 | biostudies-literature | 2024 Jan

REPOSITORIES: biostudies-literature

ACCESS DATA

Publications

Gut microbiota-derived metabolites associate with circulating immune cell subsets in unexplained recurrent spontaneous abortion.

Li Zhi Z Zheng Yongquan Y Zhang Meng M Wu Kaiqi K Zhang Long L Yao Yao Y Zheng Caihong C

Heliyon 20240117 2

Currently, the precise causes of over 40 % of recurrent spontaneous abortion (RSA) cases cannot be identified, leading to the term "unexplained RSA" (URSA). Through an exploration of the gut microbiota, metabolites, and immune cell subsets in URSA, this study establishes a link between gut microbiota-derived metabolites and immune cells. The results indicate reduced diversity in the gut microbiota of URSA. Targeted metabolomic analyses reveal decreased levels of gut microbiota-derived deoxycholi ...[more]

PMID: 38312612

Similar Datasets

Project description:BackgroundRecurrent spontaneous abortion (RSA) is defined as two or more consecutive spontaneous abortions before 20 weeks with the same spouse [1]. However, approximately 50% of RSA cases of unknown cause are classified as unexplained recurrent spontaneous abortion (URSA). Potential factors include decreased trophoblast cell migration and invasion, leading to impaired placental implantation and maintenance of the normal maternal-fetal interface. However, the mechanism of this pathogenesis remains unknown. In this study, we investigated the potential role and mechanism of KLF4 in regulating URSA by influencing the invasion and migration ability of trophoblast cells.MethodsWe firstly identified 817 differentially expressed genes by performing a difference analysis of the dataset GSE121950 [2] related to recurrent abortion, and intersected the top 10 genes obtained respectively by the three algorithms: DMNC, MNC, and EPC using Venn Diagram.To detect the expression levels of core genes, villi samples were obtained from normal pregnant women and patients with URSA. RT-qPCR analysis revealed a significant difference in KLF4 mRNA expression and KLF4 was then analyzed. Trophoblast cell lines HTR8 and JEG3 were used to investigate the effect of KLF4 on trophoblastic function. Wound healing and transwell assays was performed to detect the invasion and migration of trophoblast cells. The expression of epithelial-mesenchymal transition(EMT) molecules were detected by RT-qPCR and western blot. Promoter detection and epigenetic modification were detected by chromatin immunoprecipitation (ChIP) assay. Molecular nuclear localization was detected by immunofluorescence and subcellular fractionation. Miscarried mice model was used to study the effects of KLF4 on URSA induced by reduced trophoblast invasion and migration.ResultsKLF4 is highly expressed in the villi of patients with URSA. KLF4 inhibits the expression level of H3R2ME2a in trophoblast cells by regulating the transcriptional level and nuclear translocation of PRMT6, thereby inhibiting the possible regulatory mechanism of trophoblastic invasion and providing a potential treatment strategy for URSA in vivo.ConclusionsThe KLF4/PRMT6/H3R2ME2a axis regulates mechanisms associated with unexplained recurrent spontaneous abortion by regulating trophoblast function.

Project description:BackgroundThe precise etiology of approximately 50% of patients with recurrent spontaneous abortion (RSA) is unclear, known as unexplained recurrent spontaneous abortion (URSA). This study identified the genetic polymorphisms in patients with URSA.MethodsGenomic DNA was extracted from 30 couples with URSA and 9 couples with normal reproductive history for whole exome sequencing. Variations in annotation, filtering, and prediction of harmfulness and pathogenicity were examined. Furthermore, predictions of the effects of changes in protein structure, Sanger validation, and functional enrichment analyses were performed. The missense mutated genes with significant changes in protein function, and genes with mutations of premature stop, splice site, frameshift, and in-frame indel were selected as candidate mutated genes related to URSA.ResultsIn 30 unrelated couples with URSA, 50%, 20%, and 30% had 2, 3, and more than 4 miscarriages, respectively. Totally, 971 maternal and 954 paternal mutations were found to be pathogenic or possibly pathogenic after preliminary filtering. Total variations were not associated with age nor the number of miscarriages. In 28 patients (involving 23 couples), 22 pathogenic or possibly pathogenic variants of 19 genes were found to be strongly associated with URSA, with an abnormality rate of 76.67%. Among these, 12 missense variants showed obvious changes in protein functions, including ANXA5 (c.949G>C; p.G317R), APP (c.1530G>C; p.K510N), DNMT1 (c.2626G>A; p.G876R), FN1 (c.5621T>C; p.M1874T), MSH2 (c.1168G>A; p.L390F), THBS1 (c.2099A>G; p.N700S), KDR (c.2440G>A; p.D814N), POLR2B (c.406G>T; p.G136C), ITGB1 (c.655T>C; p.Y219H), PLK1 (c.1210G>T; p.A404S), COL4A2 (c.4808 A>C; p.H1603P), and LAMA4 (c.3158A>G; p.D1053G). Six other genes with mutations of premature stop, splice site, frameshift, and in-frame indel were also identified, including BUB1B (c.1648C>T; p.R550*) and MMP2 (c.1462_1464delTTC; p.F488del) from the father, and mutations from mother and/or father including BPTF (c.396_398delGGA; p.E138 del and c.429_431GGA; p.E148del), MECP2 (c.21_23delCGC; p.A7del), LAMA2 (HGVS: NA; Exon: NA; SPLICE_SITE, DONOR), and SOX21 (c.640 _641insT; p. A214fs, c.644dupC; p. A215fs and c.644_645ins ACGCGTCTTCTTCCCGCAGTC; p. A215dup).ConclusionsThese pathogenic or potentially pathogenic mutated genes may be potential biomarkers for URSA and may play an auxiliary role in the treatment of URSA.

Project description:BackgroundUnexplained recurrent spontaneous abortion (URSA) is one of the most challenging conditions frustrates women of childbearing age profoundly. The gene expression patterns and biological characteristics of placental villus in patients with URSA remain largely unknown. The aim of our study was to identify potential lncRNAs as well as their action mechanisms in URSA.MethodThe ceRNA microarray was used to identify the mRNA and lncRNA expression profiles of URSA patients and normal pregnancy. Functional enrichment analyses for differentially expressed mRNAs in URSA were performed. Protein-protein interaction analysis of differentially expressed mRNAs was performed to identify hub genes and key modules. Subsequently, the co-dysregulated ceRNA network of URSA was established, and the enrichment analyses for the mRNAs in the ceRNA network was implemented. qRT-PCR was performed to validated the expression of key ENST00000429019 and mRNAs in URSA.ResultsWe found that URSA placental villus have distinct mRNA and lncRNA expression profiles through ceRNA microarray, with a total of 347 mRNAs and 361 lncRNAs differentially expressed compared with controls. The functional enrichment analysis revealed that ncRNA processing, DNA replication, cell cycle, apoptosis, cytokine-mediated signaling pathway, ECM-receptor interaction were the potentially disrupted pathways in URSA patients. Then we constructed a co-dysregulated ceRNA network and found differentially expressed mRNAs were regulated by a small fraction of hub lncRNAs. Finally, we found a key network of ENST00000429019 and three cell proliferation or apoptosis related key mRNAs (CDCA3, KIFC1, NCAPH), and validated their expression and regulation in tissue and cellular levels.ConclusionsThis study identified a key ceRNA network, which might take part in URSA and correlate with cell proliferation and apoptosis. Optimistically, this study may deepen our apprehensions about the underlying molecular and biological causes of URSA and provide an important theoretical basis for future therapeutic strategies for patients with URSA.

Project description:ObjectiveTo explore the biological relationship between the regulatory signal pathways involved in differentially expressed genes and recurrent spontaneous abortion (RSA) by analyzing the gene expression microarray data of unexplained RSA.MethodsThe gene expression profile data of chorionic villi from unexplained recurrent abortion with normal karyotype and selective induced abortion were compared. Differentially expressed genes were analyzed by the "Limma" package in R Studio, and Gene Ontology(GO) and Kyoto Encyclopedia of Genes and Genomes(KEGG) pathway enrichment analysis were carried out with "Cluster Profiler" and "org.hs.eg.db" packages. Finally, hub genes were identified through constructing the protein-protein interaction (PPI) network from the differentially expressed gene dataset in the STRING database. And the hub genes were verified by RT-PCR. The expression of TH1 and TH2 cytokines representing IL-2, IL-10 and their receptors related to hub gene immune regulation were detected by enzyme-linked immunosorbent assay (ELISA) and western blot (WB), respectively.ResultsA total of 295 differentially expressed genes were identified in the dataset GSE22490, with a significance level of P < 0.05 and an absolute log-fold change > 1.0, which included 166 up-regulated genes and 129 down-regulated genes. Go and KEGG enrichment analysis of these differentially expressed genes (P < 0.05,FDR < 0.05) revealed significant involvement in the regulation of inflammatory and immune responses. The PPI analysis revealed that the hub genes FCGR3A, TLR2, BTK, CLEC7A and CD163 were centrally located in the network cluster which were composed of the proteins encoded by differentially expressed genes associated with RSA. The mRNA levels of FCGR3A, TLR2 and CLEC7A in the RSA group were significantly higher than those in the NC group (P < 0.05). The protein expression level of TLR2 was also significantly increased in the RSA group (P < 0.05). The level of IL-2 in the RSA group was significantly higher than that in the NC group (P < 0.05), while the protein expression level of its receptor was not different(P > 0.05). There was no significant difference in the expression levels of IL-10 and its receptor between the two groups (P > 0.05).ConclusionAbnormal immune response plays an important role in unexplained RSA. The imbalance in immune regulation may be one of the most important reasons behind this phenomenon. These findings provide a foundation for further research into the mechanisms underlying RSA.

Dataset Information

Gut microbiota-derived metabolites associate with circulating immune cell subsets in unexplained recurrent spontaneous abortion.

Publications

Gut microbiota-derived metabolites associate with circulating immune cell subsets in unexplained recurrent spontaneous abortion.

Similar Datasets

OmicsDI is part of the ELIXIR infrastructure

Tweets