Dataset Information

A missense variant in NCF1 is associated with susceptibility to unexplained recurrent spontaneous abortion.

ABSTRACT: Unexplained recurrent spontaneous abortion (URSA) is a major concern in reproductive medicine. Neutrophil cytosolic factor 1 (NCF1) polymorphisms leading to low production of reactive oxygen species (ROS) are strongly associated with autoimmune diseases. We investigated the association of the missense single nucleotide polymorphism (SNP) rs201802880 (NCF1-339) in NCF1 with URSA and explored its function. We performed NCF1-339 SNP genotyping of samples from 152 Chinese patients with URSA and 72 healthy controls using nested PCR and TaqMan assays. ROS production and RELA (NF-κB subunit) expression in the blood of participants with different NCF1-339 genotypes were determined. The frequencies of the wild-type (GG) and mutant (GA) genotypes remarkably differed between the URSA and control groups. The mutant genotype was associated with an increased risk of recurrent abortion. Furthermore, ROS levels in the URSA group with the GG genotype were significantly higher than those in the group with the GA genotype (p < 0.05). RELA expression in URSA patients with the GA genotype was considerably higher than that in control individuals with the GG genotype. These findings indicate that mutations in NCF1 may increase the risk of URSA via the NADP/ROS/NF-κB signaling pathway, which has implications for the diagnosis and treatment of URSA.

SUBMITTER: Du M

PROVIDER: S-EPMC9663937 | biostudies-literature | 2022

REPOSITORIES: biostudies-literature

ACCESS DATA

Publications

A missense variant in NCF1 is associated with susceptibility to unexplained recurrent spontaneous abortion.

Du Mengxuan M Gu Heng H Li Yanqiu Y Huang Liyan L Gao Mengge M Xu Hang H Deng Huaqian H Zhong Wenyao W Liu Xiaohua X Zhong Xingming X

Open life sciences 20221114 1

Unexplained recurrent spontaneous abortion (URSA) is a major concern in reproductive medicine. Neutrophil cytosolic factor 1 (NCF1) polymorphisms leading to low production of reactive oxygen species (ROS) are strongly associated with autoimmune diseases. We investigated the association of the missense single nucleotide polymorphism (SNP) rs201802880 (NCF1-339) in NCF1 with URSA and explored its function. We performed NCF1-339 SNP genotyping of samples from 152 Chinese patients with ...[more]

PMID: 36448060

Similar Datasets

Project description:BackgroundUnexplained recurrent spontaneous abortion (URSA) is one of the most challenging conditions frustrates women of childbearing age profoundly. The gene expression patterns and biological characteristics of placental villus in patients with URSA remain largely unknown. The aim of our study was to identify potential lncRNAs as well as their action mechanisms in URSA.MethodThe ceRNA microarray was used to identify the mRNA and lncRNA expression profiles of URSA patients and normal pregnancy. Functional enrichment analyses for differentially expressed mRNAs in URSA were performed. Protein-protein interaction analysis of differentially expressed mRNAs was performed to identify hub genes and key modules. Subsequently, the co-dysregulated ceRNA network of URSA was established, and the enrichment analyses for the mRNAs in the ceRNA network was implemented. qRT-PCR was performed to validated the expression of key ENST00000429019 and mRNAs in URSA.ResultsWe found that URSA placental villus have distinct mRNA and lncRNA expression profiles through ceRNA microarray, with a total of 347 mRNAs and 361 lncRNAs differentially expressed compared with controls. The functional enrichment analysis revealed that ncRNA processing, DNA replication, cell cycle, apoptosis, cytokine-mediated signaling pathway, ECM-receptor interaction were the potentially disrupted pathways in URSA patients. Then we constructed a co-dysregulated ceRNA network and found differentially expressed mRNAs were regulated by a small fraction of hub lncRNAs. Finally, we found a key network of ENST00000429019 and three cell proliferation or apoptosis related key mRNAs (CDCA3, KIFC1, NCAPH), and validated their expression and regulation in tissue and cellular levels.ConclusionsThis study identified a key ceRNA network, which might take part in URSA and correlate with cell proliferation and apoptosis. Optimistically, this study may deepen our apprehensions about the underlying molecular and biological causes of URSA and provide an important theoretical basis for future therapeutic strategies for patients with URSA.

Project description:BackgroundThe precise etiology of approximately 50% of patients with recurrent spontaneous abortion (RSA) is unclear, known as unexplained recurrent spontaneous abortion (URSA). This study identified the genetic polymorphisms in patients with URSA.MethodsGenomic DNA was extracted from 30 couples with URSA and 9 couples with normal reproductive history for whole exome sequencing. Variations in annotation, filtering, and prediction of harmfulness and pathogenicity were examined. Furthermore, predictions of the effects of changes in protein structure, Sanger validation, and functional enrichment analyses were performed. The missense mutated genes with significant changes in protein function, and genes with mutations of premature stop, splice site, frameshift, and in-frame indel were selected as candidate mutated genes related to URSA.ResultsIn 30 unrelated couples with URSA, 50%, 20%, and 30% had 2, 3, and more than 4 miscarriages, respectively. Totally, 971 maternal and 954 paternal mutations were found to be pathogenic or possibly pathogenic after preliminary filtering. Total variations were not associated with age nor the number of miscarriages. In 28 patients (involving 23 couples), 22 pathogenic or possibly pathogenic variants of 19 genes were found to be strongly associated with URSA, with an abnormality rate of 76.67%. Among these, 12 missense variants showed obvious changes in protein functions, including ANXA5 (c.949G>C; p.G317R), APP (c.1530G>C; p.K510N), DNMT1 (c.2626G>A; p.G876R), FN1 (c.5621T>C; p.M1874T), MSH2 (c.1168G>A; p.L390F), THBS1 (c.2099A>G; p.N700S), KDR (c.2440G>A; p.D814N), POLR2B (c.406G>T; p.G136C), ITGB1 (c.655T>C; p.Y219H), PLK1 (c.1210G>T; p.A404S), COL4A2 (c.4808 A>C; p.H1603P), and LAMA4 (c.3158A>G; p.D1053G). Six other genes with mutations of premature stop, splice site, frameshift, and in-frame indel were also identified, including BUB1B (c.1648C>T; p.R550*) and MMP2 (c.1462_1464delTTC; p.F488del) from the father, and mutations from mother and/or father including BPTF (c.396_398delGGA; p.E138 del and c.429_431GGA; p.E148del), MECP2 (c.21_23delCGC; p.A7del), LAMA2 (HGVS: NA; Exon: NA; SPLICE_SITE, DONOR), and SOX21 (c.640 _641insT; p. A214fs, c.644dupC; p. A215fs and c.644_645ins ACGCGTCTTCTTCCCGCAGTC; p. A215dup).ConclusionsThese pathogenic or potentially pathogenic mutated genes may be potential biomarkers for URSA and may play an auxiliary role in the treatment of URSA.

Dataset Information

A missense variant in NCF1 is associated with susceptibility to unexplained recurrent spontaneous abortion.

Publications

A missense variant in <i>NCF1</i> is associated with susceptibility to unexplained recurrent spontaneous abortion.

Similar Datasets

OmicsDI is part of the ELIXIR infrastructure

Tweets