Dataset Information

Gene polymorphism associated with endothelial nitric oxide synthase (4VNTR, G894T, C786T) and unexplained recurrent spontaneous abortion risk: A meta-analysis.

ABSTRACT: To evaluate the association between endothelial nitric oxide synthase gene polymorphisms (4VNTR A/B, G894T, C786T) and risk of URSA.Related case-control studies were collected by computers. A meta-analysis was conducted using Stata 12.0 software to assess the strength of association.Altogether 37 articles were examining the relationship between endothelial nitric oxide synthase gene polymorphisms and URSA, among which sixteen (16) studies were related to 4VNTR, twelve (12) to G894T, and nine (9) to C786T, the study suggested that 4VNTR A/B polymorphism was closely connected with URSA risk under all gene models except for recessive model (AA vs. BB?+?AB). The integrated result which indicated the association between G894T gene mutation and URSA risk had been shown under homozygote (TT vs. GG; OR 1.585, 95%CI 1.175-2.138) and recessive models (TT vs. TG?+?GG; OR 1.530, 95%CI 1.142-2.052). Considering heterogeneity in the remaining gene models, subgroup analysis was performed on ethnicity, and the results showed that it was the dominant (TT?+?TG vs. GG; OR 1.585, 95%CI 1.175-2.138) and additive models (T vs. G; OR 1.727, 95%CI 1.372-2.175) of G894T in Asians and the heterozygote model (TG vs. GG; OR 1.015, 95%CI 0.846-1.217) in Caucasians that were associated with URSA (P?

SUBMITTER: Zhao X

PROVIDER: S-EPMC6358376 | biostudies-literature | 2019 Jan

REPOSITORIES: biostudies-literature

ACCESS DATA

Publications

Gene polymorphism associated with endothelial nitric oxide synthase (4VNTR, G894T, C786T) and unexplained recurrent spontaneous abortion risk: A meta-analysis.

Zhao Xiaoxuan X Li Qiang Q Yu Feifei F Lin Lina L Yin Wenqing W Li Jiawei J Feng Xiaoling X

Medicine 20190101 4

To evaluate the association between endothelial nitric oxide synthase gene polymorphisms (4VNTR A/B, G894T, C786T) and risk of URSA.Related case-control studies were collected by computers. A meta-analysis was conducted using Stata 12.0 software to assess the strength of association.Altogether 37 articles were examining the relationship between endothelial nitric oxide synthase gene polymorphisms and URSA, among which sixteen (16) studies were related to 4VNTR, twelve (12) to G894T, and nine (9) ...[more]

PMID: 30681586

Similar Datasets

Project description:BackgroundThe precise etiology of approximately 50% of patients with recurrent spontaneous abortion (RSA) is unclear, known as unexplained recurrent spontaneous abortion (URSA). This study identified the genetic polymorphisms in patients with URSA.MethodsGenomic DNA was extracted from 30 couples with URSA and 9 couples with normal reproductive history for whole exome sequencing. Variations in annotation, filtering, and prediction of harmfulness and pathogenicity were examined. Furthermore, predictions of the effects of changes in protein structure, Sanger validation, and functional enrichment analyses were performed. The missense mutated genes with significant changes in protein function, and genes with mutations of premature stop, splice site, frameshift, and in-frame indel were selected as candidate mutated genes related to URSA.ResultsIn 30 unrelated couples with URSA, 50%, 20%, and 30% had 2, 3, and more than 4 miscarriages, respectively. Totally, 971 maternal and 954 paternal mutations were found to be pathogenic or possibly pathogenic after preliminary filtering. Total variations were not associated with age nor the number of miscarriages. In 28 patients (involving 23 couples), 22 pathogenic or possibly pathogenic variants of 19 genes were found to be strongly associated with URSA, with an abnormality rate of 76.67%. Among these, 12 missense variants showed obvious changes in protein functions, including ANXA5 (c.949G>C; p.G317R), APP (c.1530G>C; p.K510N), DNMT1 (c.2626G>A; p.G876R), FN1 (c.5621T>C; p.M1874T), MSH2 (c.1168G>A; p.L390F), THBS1 (c.2099A>G; p.N700S), KDR (c.2440G>A; p.D814N), POLR2B (c.406G>T; p.G136C), ITGB1 (c.655T>C; p.Y219H), PLK1 (c.1210G>T; p.A404S), COL4A2 (c.4808 A>C; p.H1603P), and LAMA4 (c.3158A>G; p.D1053G). Six other genes with mutations of premature stop, splice site, frameshift, and in-frame indel were also identified, including BUB1B (c.1648C>T; p.R550*) and MMP2 (c.1462_1464delTTC; p.F488del) from the father, and mutations from mother and/or father including BPTF (c.396_398delGGA; p.E138 del and c.429_431GGA; p.E148del), MECP2 (c.21_23delCGC; p.A7del), LAMA2 (HGVS: NA; Exon: NA; SPLICE_SITE, DONOR), and SOX21 (c.640 _641insT; p. A214fs, c.644dupC; p. A215fs and c.644_645ins ACGCGTCTTCTTCCCGCAGTC; p. A215dup).ConclusionsThese pathogenic or potentially pathogenic mutated genes may be potential biomarkers for URSA and may play an auxiliary role in the treatment of URSA.

Dataset Information

Gene polymorphism associated with endothelial nitric oxide synthase (4VNTR, G894T, C786T) and unexplained recurrent spontaneous abortion risk: A meta-analysis.

Publications

Gene polymorphism associated with endothelial nitric oxide synthase (4VNTR, G894T, C786T) and unexplained recurrent spontaneous abortion risk: A meta-analysis.

Similar Datasets

OmicsDI is part of the ELIXIR infrastructure

Tweets