Dataset Information

Novel SLC5A2 mutation contributes to familial renal glucosuria: Abnormal expression in renal tissues.

ABSTRACT: Familial renal glucosuria (FRG) is characterized by persistent glucosuria in the presence of normal serum glucose concentrations, while other impairments of tubular function are absent. Mutations in the sodium-glucose co-transporter 2 (SLC5A2) gene have been found to be responsible for FRG. However, direct evidence for the presence of SLC5A2 mutant in renal tissues is very rare. In previous studies, a non-sense mutation (c.1320 G>A:p.W440X) that would cause premature termination of the protein was found. However, the effects in the renal tissues were not reported. In the current study, a patient with FRG and a urinary glucose excretion rate of 8.3 g/day is described, for whom a novel missense mutation (c.1319G>A:p.W440X) was revealed by sequencing. Furthermore, in the immunofluorescence examination of a renal biopsy specimen, SLC5A2 was detected in the apical side of the proximal convoluted tubule, discontinuously decreased in comparison with that in normal and disease controls. The results imply that both wild-type SLC5A2 and mutant SLC5A2 with abnormal distribution were expressed in the renal tissues, and that the reduction of SLC5A2 expression and function were due to the c.1319G>A:p.W440X mutation. The current study provides valuable clues regarding the SLC5A2 molecule from genotype to phenotype in families affected by FRG.

SUBMITTER: Yu L

PROVIDER: S-EPMC4950299 | biostudies-literature | 2016 Aug

REPOSITORIES: biostudies-literature

ACCESS DATA

Publications

Novel <i>SLC5A2</i> mutation contributes to familial renal glucosuria: Abnormal expression in renal tissues.

Yu Lei L Hou Ping P Liu Guo-Ping GP Zhang Hong H

Experimental and therapeutic medicine 20160525 2

Familial renal glucosuria (FRG) is characterized by persistent glucosuria in the presence of normal serum glucose concentrations, while other impairments of tubular function are absent. Mutations in the sodium-glucose co-transporter 2 (<i>SLC5A2</i>) gene have been found to be responsible for FRG. However, direct evidence for the presence of SLC5A2 mutant in renal tissues is very rare. In previous studies, a non-sense mutation (c.1320 G>A:p.W440X) that would cause premature termination of the pr ...[more]

PMID: 27446256

Similar Datasets

Project description:BACKGROUND:Familial renal glucosuria (FRG) is characterized by persistent glucosuria without other impairments of tubular function in the presence of normal serum glucose. SGLT2, which is almost exclusively expressed in the kidney, accounts for most of the glucose reabsorption. Recently, some studies have confirmed that SLC5A2 mutations are responsible for the pathogenesis of familial renal glucosuria, but FRG cases are still rare. Furthermore, there are a few reports about splice-site mutations in previous studies, but the effect of these variants at the mRNA level has hardly been verified. METHODS:Ten patients were recruited in our renal division because of persistent glucosuria, and clinical data of the patients and their family members were recorded as much as possible. The entire coding region and adjacent intronic segments of SLC5A2 were sequenced in FRG patients and their relatives. Permanent growing lymphoblastoid cell lines from FRG patients were established to better preserve genetic information. RESULTS:A total of nine different mutations were identified: IVS1-16C?>?A, c.305C?>?T/p.(A102V), c.395G?>?A/p.(R132H), c.736C?>?T/p.(P246S), c.886(-10_-31)delGCAAGCGGGCAGCTGAACGCCC, c.1152_1163delGGTCATGCTGGC/p.(Val385_Ala388del), c.1222G?>?T/p.(D408Y), c.1496G?>?A/p.(R499H) and c.1540C?>?T/p.(P514S); two novel mutations in SLC5A2, c.1222G?>?T/p.(D408Y) and c.1496G?>?A/p.(R499H), were identified in the Chinese FRG pedigrees. Ten individuals with heterozygous or compound heterozygous variants had glucosuria in the range of 3.1 to 37.6?g/d. CONCLUSION:We screened ten additional Chinese FRG pedigrees for mutations in the SLC5A2 gene and found nine mutations, including two novel mutations. Most variants were private, but IVS1-16C?>?A and c.886(-10_-31) del may be high frequency splice-site mutations that could be preferentially screened when variants cannot be found in the SLC5A2 exon. Furthermore, we successfully established a permanent growing lymphoblastoid cell line from patients with FRG, which could facilitate further studies of the SLC5A2 gene. The current study provides a valuable clue for further research on the molecular mechanism of SGLT2.

Dataset Information

Novel SLC5A2 mutation contributes to familial renal glucosuria: Abnormal expression in renal tissues.

Publications

Novel <i>SLC5A2</i> mutation contributes to familial renal glucosuria: Abnormal expression in renal tissues.

Similar Datasets

OmicsDI is part of the ELIXIR infrastructure

Tweets