Browse
Submit Data
Databases
API
Help

Dataset Information

28 Views

0 Connections

0 Citations

0 Reanalyses

0 Downloads

Omics score: 0

CD97 is a critical regulator of acute myeloid leukemia stem cell function.

ABSTRACT: Despite significant efforts to improve therapies for acute myeloid leukemia (AML), clinical outcomes remain poor. Understanding the mechanisms that regulate the development and maintenance of leukemic stem cells (LSCs) is important to reveal new therapeutic opportunities. We have identified CD97, a member of the adhesion class of G protein-coupled receptors (GPCRs), as a frequently up-regulated antigen on AML blasts that is a critical regulator of blast function. High levels of CD97 correlate with poor prognosis, and silencing of CD97 reduces disease aggressiveness in vivo. These phenotypes are due to CD97's ability to promote proliferation, survival, and the maintenance of the undifferentiated state in leukemic blasts. Collectively, our data credential CD97 as a promising therapeutic target on LSCs in AML.

SUBMITTER: Martin GH

PROVIDER: S-EPMC6781010 | biostudies-literature | 2019 Oct

REPOSITORIES: biostudies-literature

ACCESS DATA

Json Xml

Publications

CD97 is a critical regulator of acute myeloid leukemia stem cell function.

Martin Gaëlle H GH Roy Nainita N Chakraborty Sohini S Desrichard Alexis A Chung Stephen S SS Woolthuis Carolien M CM Hu Wenhuo W Berezniuk Iryna I Garrett-Bakelman Francine E FE Hamann Jörg J Devlin Sean M SM Chan Timothy A TA Park Christopher Y CY

The Journal of experimental medicine 20190801 10

Despite significant efforts to improve therapies for acute myeloid leukemia (AML), clinical outcomes remain poor. Understanding the mechanisms that regulate the development and maintenance of leukemic stem cells (LSCs) is important to reveal new therapeutic opportunities. We have identified CD97, a member of the adhesion class of G protein-coupled receptors (GPCRs), as a frequently up-regulated antigen on AML blasts that is a critical regulator of blast function. High levels of CD97 correlate wi ...[more]

PMID: 31371381

Similar Datasets

CD97 is a Critical Regulator of Acute Myeloid Leukemia Stem Cell Function

Project description:Despite significant efforts to improve therapies for acute myeloid leukemia (AML), clinical outcomes remain poor. Understanding the mechanisms that regulate the development and maintenance of leukemic stem cells (LSC) is important to reveal new therapeutic opportunities. We have identified CD97, a member of the adhesion class of G-protein coupled receptors (GPCRs), as a frequently upregulated antigen of AML blasts that is a critical regulator of blast function. High levels of CD97 correlate with poor prognosis, and silencing of CD97 reduces disease aggressiveness in vivo. In order to analyze the functional pathways associated with CD97 expression, we generated RNA-sequence data from scrambled shRNA transfected (s-shRNA) and CD97 KD human AML cell line HL60, as well as from MLL-AF9 (MA9) transduced GMPs isolated from CD97-/- and WT mice. These phenotypes are due to CD97’s function to promote proliferation, survival, and the maintenance of the undifferentiated state in leukemic blasts. Collectively, our data credential CD97 as a promising therapeutic target on LSCs in AML.

2019-07-30 | GSE135028 | GEO

CD97 is a Critical Regulator of Acute Myeloid Leukemia Stem Cell Function

Project description:CD97 is a Critical Regulator of Acute Myeloid Leukemia Stem Cell Function

| PRJNA557192 | ENA

SYK is a critical regulator of FLT3 in acute myeloid leukemia.

| S-EPMC4106711 | biostudies-literature

CD97 expression is associated with poor overall survival in acute myeloid leukemia.

Project description:CD97, a member of the adhesion G-protein coupled receptor family, is normally expressed on leukocytes and smooth muscles. CD97 is also expressed in a variety of solid cancers, particularly those with aggressive metastatic phenotypes. Here we characterize the clinical significance of CD97 in acute myeloid leukemia (AML). We analyzed 173 patients from the TCGA AML data set and found that CD97 was higher in cytogenetically normal patients compared with cytogenetically abnormal patients (p = 0.023). High CD97 was also associated with NPM1 mutations (p = 0.0033). Patients with high CD97 expression had shorter overall (median: 7.35 months vs. 24.1 months, p = 0.0015) and disease-free (median DFS: 8.2 months vs. 18.2 months, p = 0.017) survival. Importantly, we identified pathways involved in the leukemia stem cell interaction with the bone marrow niche, such as integrin, CXCR4, and interleukin-8, among the most upregulated signaling pathways in patients with high CD97 expression. Our results suggest that high CD97 expression is associated with poor clinical outcome and indicate a need for future functional and mechanistic studies to investigate the role of CD97 in AML.

| S-EPMC7473776 | biostudies-literature

CaMK2D is a critical regulator of coactivation of leukemia stem cell factors in acute myeloid leukemia.

Project description:Relapse is one of the biggest challenges in treating acute myeloid leukemia (AML) due to leukemia stem cells (LSCs) resisting chemotherapy, providing a cellular reservoir to form the basis for relapse. Here, we identify CaMK2D is a critical regulator of stemness and leukemogenesis of AML. Transcriptionally, loss of CaMK2D was associated with down-regulation kinds of metabolic pathway of AML.

2021-11-08 | GSE161032 | GEO

Six1 regulates leukemia stem cell maintenance in acute myeloid leukemia.

Project description:Molecular genetic changes in acute myeloid leukemia (AML) play crucial roles in leukemogenesis, including recurrent chromosome translocations, epigenetic/spliceosome mutations and transcription factor aberrations. Six1, a transcription factor of the Sine oculis homeobox (Six) family, has been shown to transform normal hematopoietic progenitors into leukemia in cooperation with Eya. However, the specific role and the underlying mechanism of Six1 in leukemia maintenance remain unexplored. Here, we showed increased expression of SIX1 in AML patients and murine leukemia stem cells (c-Kit+ cells, LSCs). Importantly, we also observed that a higher level of Six1 in human patients predicts a worse prognosis. Notably, knockdown of Six1 significantly prolonged the survival of MLL-AF9-induced AML mice with reduced peripheral infiltration and tumor burden. AML cells from Six1-knockdown (KD) mice displayed a significantly decreased number and function of LSC, as assessed by the immunophenotype, colony-forming ability and limiting dilution assay. Further analysis revealed the augmented apoptosis of LSC and decreased expression of glycolytic genes in Six1 KD mice. Overall, our data showed that Six1 is essential for the progression of MLL-AF9-induced AML via maintaining the pool of LSC.

| S-EPMC6609858 | biostudies-literature

Leukemia Stem Cell Release From the Stem Cell Niche to Treat Acute Myeloid Leukemia.

Project description:Acute myeloid leukemia (AML) is a heterogeneous, complex, and deadly disease, whose treatment has hardly evolved for decades and grounds on the use of intensive chemotherapy regimens. Chemotherapy helps reduce AML bulk, but promotes relapse in the long-run by selection of chemoresistant leukemia stem cells (LSC). These may diversify and result in progression to more aggressive forms of AML. In vivo models suggest that the bone marrow stem cell niche helps LSC stay dormant and protected from chemotherapy. Here, we summarize relevant changes in stem cell niche homing and adhesion of AML LSC vs. healthy hematopoietic stem cells, and provide an overview of clinical trials aiming at targeting these processes for AML treatment and future directions within this field. Promising results with various non-mutation-targeted novel therapies directed to LSC eradication via interference with their anchoring to the stem cell niche have encouraged on-going or future advanced phase III clinical trials. In the coming years, we may see a shift in the focus of AML treatment to LSC-directed therapies if the prospect of improved cure rates holds true. In the future, AML treatment should lean toward personalized therapies using combinations of these compounds plus mutation-targeted agents and/or targeted delivery of chemotherapy, aiming at LSC eradication with reduced side effects.

| S-EPMC7367216 | biostudies-literature

Allogeneic stem cell transplantation for acute myeloid leukemia.

Project description: Not available

| S-EPMC2878779 | biostudies-literature

PRKCH regulates hematopoietic stem cell function and predicts poor prognosis in acute myeloid leukemia.

Project description:Acute myeloid leukemia (AML) cells often co-opt normal hematopoietic stem cell (HSC) programs to drive neoplastic proliferation, and HSC-related gene expression signatures have been identified as biomarkers for poor prognosis in AML patients. We sought to identify new regulators of HSCs and AML cells from previously published HSC and leukemia stem cell (LSC) gene expression signatures. We identified PRKCH (protein kinase C eta) as a gene that is highly expressed in both mouse and human HSCs, as well as in LSCs from independent cohorts of AML patients. Prkch deletion in mice resulted in impaired HSC function. PRKCH was most highly expressed in undifferentiated (FAB M0) subtype AML, and high expression correlated with TP53 and RUNX1 mutations, high-risk cytogenetic features, and poor overall survival. Prkch deletion in an Flt3-ITD/Runx1 mutant mouse AML model did not extend survival. Thus, PRKCH is necessary for normal HSC function; its expression predicts poor survival in AML patients, but it is not required for AML to develop.

| S-EPMC6731097 | biostudies-literature

SYK Is a Critical Regulator of FLT3 In Acute Myeloid Leukemia

Project description:Cooperative dependencies between mutant oncoproteins and wild-type proteins are critical in cancer pathogenesis and therapy resistance. Although spleen tyrosine kinase (SYK) has been implicated in hematologic malignancies, it is rarely mutated. We used kinase activity profiling to identify collaborators of SYK in acute myeloid leukemia (AML) and determined that FMS-like tyrosine kinase 3 (FLT3) is transactivated by SYK via direct binding. Highly activated SYK is predominantly found in FLT3-ITD positive AML and cooperates with FLT3-ITD to activate MYC transcriptional programs. FLT3-ITD AML cells are more vulnerable to SYK suppression than FLT3 wild-type counterparts. In a FLT3-ITD in vivo model, SYK is indispensable for myeloproliferative disease (MPD) development, and SYK overexpression promotes overt transformation to AML and resistance to FLT3-ITD-targeted therapy. HL-60, MOLM-14, and U937 cell lines were transduced in triplicate with a control luciferase-directed shRNA (target sequence CCTAAGGTTAAGTCGCCCTCG), and in duplicate with two SYK-directed shRNAs: shSYK_1 (clone ID TRCN0000197257, target sequence GCAGCAGAACAGACATGTCAA) and shSYK_2 (clone ID TRCN0000003163 , target sequence GCAGGCCATCATCAGTCAGAA), and were then selected with 1 Âµg/ml puromycin 48 hours post-infection. At day 5 post-infection, RNA was extracted and profiled using HT HG-U133A arrays (Affymetrix) at the Broad Institute (Cambridge, MA, USA). The computational analysis of the gene expression data was performed through the Genome Space bioinformatics platform (http://www.genomespace.org).

2014-01-15 | E-GEOD-54065 | biostudies-arrayexpress

OmicsDI is part of the ELIXIR infrastructure

OmicsDI is an Elixir interoperability service. Learn more ›

Tweets

OmicsDI Databases

PRIDE
PeptideAtlas
MassIVE
JPOST Repository
Physiome Model Repository

EGA
EVA
ENA
LINCS
PAXDB
Cell Collective

MetaboLights
Metabolomics Workbench
MetabolomeExpress
GNPS
BioModels
FAIRDOMHub

ArrayExpress
dbGaP
ExpressionAtlas
GEO
NODE

Information

Databases
Help
API
Contact us
Code on GitHub
Terms of use
Submit Data