Dataset Information

Frequency of HLA‑G UTR‑1/UTR‑3/UTR‑7 in women with unexplained recurrent spontaneous abortion.

ABSTRACT: Human leukocyte antigen (HLA)-G is an important molecule that maintains maternal-fetal interface tolerance and plays a vital role in a healthy pregnancy. Single-nucleotide polymorphisms in the 3'-untranslated regions (UTR) of the HLA-G gene may differ in women with unexplained recurrent spontaneous abortion (URSA). The present study involved the isolation of genome DNA from peripheral blood leukocytes, Sanger sequencing and analysis of the polymorphism sites in the 3'UTR of the HLA-G gene based on polymerase chain reaction. In total, 261 DNA samples from cases of URSA (n=133), including primary URSA (n=83) and secondary URSA (n=50), and controls (n=128) were evaluated. The present data showed that +3010CC genotype carriers exhibited a higher risk of URSA, while +3187GG genotype carriers exhibited a lower risk. Secondary URSA patients carrying +3010C had a higher risk of URSA, while +3187G carriers exhibited a lower risk of URSA. UTR-1 haplotype carriers may be associated with a reduced risk of primary and secondary URSA. Notably, UTR-3 and UTR-7 could increase the risk of primary and secondary URSA, respectively. The present results showed that HLA-G 3'UTR polymorphisms and haplotypes may be involved in URSA development and be a predictor of pregnancy outcome.

SUBMITTER: Bai W

PROVIDER: S-EPMC9634346 | biostudies-literature | 2022 Dec

REPOSITORIES: biostudies-literature

ACCESS DATA

Publications

Frequency of HLA‑G UTR‑1/UTR‑3/UTR‑7 in women with unexplained recurrent spontaneous abortion.

Bai Wei W Lin Zhi Z Ye Jin J Zhou Linshuang L Xi Jingqiao J Cai Wenpin W

Experimental and therapeutic medicine 20221024 6

Human leukocyte antigen (HLA)-G is an important molecule that maintains maternal-fetal interface tolerance and plays a vital role in a healthy pregnancy. Single-nucleotide polymorphisms in the 3'-untranslated regions (UTR) of the HLA-G gene may differ in women with unexplained recurrent spontaneous abortion (URSA). The present study involved the isolation of genome DNA from peripheral blood leukocytes, Sanger sequencing and analysis of the polymorphism sites in the 3'UTR of the HLA-G gene based ...[more]

PMID: 36382089

Similar Datasets

Project description:BackgroundThe precise etiology of approximately 50% of patients with recurrent spontaneous abortion (RSA) is unclear, known as unexplained recurrent spontaneous abortion (URSA). This study identified the genetic polymorphisms in patients with URSA.MethodsGenomic DNA was extracted from 30 couples with URSA and 9 couples with normal reproductive history for whole exome sequencing. Variations in annotation, filtering, and prediction of harmfulness and pathogenicity were examined. Furthermore, predictions of the effects of changes in protein structure, Sanger validation, and functional enrichment analyses were performed. The missense mutated genes with significant changes in protein function, and genes with mutations of premature stop, splice site, frameshift, and in-frame indel were selected as candidate mutated genes related to URSA.ResultsIn 30 unrelated couples with URSA, 50%, 20%, and 30% had 2, 3, and more than 4 miscarriages, respectively. Totally, 971 maternal and 954 paternal mutations were found to be pathogenic or possibly pathogenic after preliminary filtering. Total variations were not associated with age nor the number of miscarriages. In 28 patients (involving 23 couples), 22 pathogenic or possibly pathogenic variants of 19 genes were found to be strongly associated with URSA, with an abnormality rate of 76.67%. Among these, 12 missense variants showed obvious changes in protein functions, including ANXA5 (c.949G>C; p.G317R), APP (c.1530G>C; p.K510N), DNMT1 (c.2626G>A; p.G876R), FN1 (c.5621T>C; p.M1874T), MSH2 (c.1168G>A; p.L390F), THBS1 (c.2099A>G; p.N700S), KDR (c.2440G>A; p.D814N), POLR2B (c.406G>T; p.G136C), ITGB1 (c.655T>C; p.Y219H), PLK1 (c.1210G>T; p.A404S), COL4A2 (c.4808 A>C; p.H1603P), and LAMA4 (c.3158A>G; p.D1053G). Six other genes with mutations of premature stop, splice site, frameshift, and in-frame indel were also identified, including BUB1B (c.1648C>T; p.R550*) and MMP2 (c.1462_1464delTTC; p.F488del) from the father, and mutations from mother and/or father including BPTF (c.396_398delGGA; p.E138 del and c.429_431GGA; p.E148del), MECP2 (c.21_23delCGC; p.A7del), LAMA2 (HGVS: NA; Exon: NA; SPLICE_SITE, DONOR), and SOX21 (c.640 _641insT; p. A214fs, c.644dupC; p. A215fs and c.644_645ins ACGCGTCTTCTTCCCGCAGTC; p. A215dup).ConclusionsThese pathogenic or potentially pathogenic mutated genes may be potential biomarkers for URSA and may play an auxiliary role in the treatment of URSA.

Project description:BackgroundUnexplained recurrent spontaneous abortion (URSA) is one of the most challenging conditions frustrates women of childbearing age profoundly. The gene expression patterns and biological characteristics of placental villus in patients with URSA remain largely unknown. The aim of our study was to identify potential lncRNAs as well as their action mechanisms in URSA.MethodThe ceRNA microarray was used to identify the mRNA and lncRNA expression profiles of URSA patients and normal pregnancy. Functional enrichment analyses for differentially expressed mRNAs in URSA were performed. Protein-protein interaction analysis of differentially expressed mRNAs was performed to identify hub genes and key modules. Subsequently, the co-dysregulated ceRNA network of URSA was established, and the enrichment analyses for the mRNAs in the ceRNA network was implemented. qRT-PCR was performed to validated the expression of key ENST00000429019 and mRNAs in URSA.ResultsWe found that URSA placental villus have distinct mRNA and lncRNA expression profiles through ceRNA microarray, with a total of 347 mRNAs and 361 lncRNAs differentially expressed compared with controls. The functional enrichment analysis revealed that ncRNA processing, DNA replication, cell cycle, apoptosis, cytokine-mediated signaling pathway, ECM-receptor interaction were the potentially disrupted pathways in URSA patients. Then we constructed a co-dysregulated ceRNA network and found differentially expressed mRNAs were regulated by a small fraction of hub lncRNAs. Finally, we found a key network of ENST00000429019 and three cell proliferation or apoptosis related key mRNAs (CDCA3, KIFC1, NCAPH), and validated their expression and regulation in tissue and cellular levels.ConclusionsThis study identified a key ceRNA network, which might take part in URSA and correlate with cell proliferation and apoptosis. Optimistically, this study may deepen our apprehensions about the underlying molecular and biological causes of URSA and provide an important theoretical basis for future therapeutic strategies for patients with URSA.

Project description:BackgroundRecurrent spontaneous abortion (RSA) refers to 2 or more consecutive pregnancy losses, and RSA with unknown causes is called unexplained recurrent spontaneous abortion (URSA). Tim-3, a subtype of the T-cell immunoglobulin domain and mucin domain (Tim) protein family, might be an important regulatory molecule that plays a pivotal role in URSA, which might be triggered mostly by Th1/Th2 immune deviation. To understand the etiology and pathogenesis of URSA in Han Chinese women, we investigated the association between polymorphisms of rs10053538 and rs10515746 in the promoter of Tim-3 and the risk of URSA in Han Chinese women.MethodsOne hundred and forty-eight women with RSA resulting in still birth were enrolled in the URSA group. We performed tests to rule out congenital reproductive system malformation, reproductive system tumor, endocrine dyscrasia, and chromosome abnormalities. One hundred and fifty-three women with normal pregnancy leading to live birth were selected at random to comprise the control group. All women included in this study were genetically unrelated Han Chinese women. Polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) and allele-specific polymerase chain reaction (AS-PCR) were used to determine polymorphisms of rs10053538 and rs10515746, respectively, in all subjects. PCR products were chosen at random for sequencing.ResultsNo significant statistical difference was found between the distribution frequency of the GT + TT genotype and T allele on the rs10053538 locus in the URSA group or the control group (10.1% vs. 11.8%, Chi(2) = 0.205, P = 0.651; 5.1% vs. 6.5%, Chi(2) = 0.592, P = 0.441; respectively). Neither was there a significant difference between the distribution frequency of the GT + TT genotype and T allele on the rs10515746 locus in the groups (6.8% vs. 3.9%, Chi(2)1.201, P = 0.273; 3.4% vs. 2.0%, Chi(2) = 1.169, P = 0.280; respectively).ConclusionsThe present study suggested that these polymorphisms of rs10053538 or rs10515746 in the Tim-3 promoter may not be associated with URSA in Han Chinese women.

Dataset Information

Frequency of HLA‑G UTR‑1/UTR‑3/UTR‑7 in women with unexplained recurrent spontaneous abortion.

Publications

Frequency of HLA‑G UTR‑1/UTR‑3/UTR‑7 in women with unexplained recurrent spontaneous abortion.

Similar Datasets

OmicsDI is part of the ELIXIR infrastructure

Tweets