Browse
Submit Data
Databases
API
Help

Dataset Information

0 Views

0 Connections

0 Citations

0 Reanalyses

0 Downloads

Omics score: 0

The effect of cardiac troponin T2 knockdown on gene expression in zebrafish embryos

ABSTRACT: We examined the transcriptional effect of preventing cardiac contraction in zebrafish embryos which can be deprived of circulation without experiencing hypoxia since the fish obtain sufficient oxygen via diffusion. Morpholino antisense knockdown of cardiac troponin T2 (tnnt2) prevented cardiac contraction without affecting vascular development. We concluded that absence of hemodynamic force induces endothelial CXCR4a up-regulation and promotes recovery of blood flow. We used microarrays to define the genetic signatures of the development of collateral vessels in zebrafish. Keywords: Time course comparison of wild type zebrafish embryos and morpholino antisense against troponin t2 treated embryos.

ORGANISM(S): Danio rerio

PROVIDER: GSE16740 | GEO | 2009/06/24

SECONDARY ACCESSION(S): PRJNA117435

REPOSITORIES: GEO

ACCESS DATA

Json Xml

Dataset's files

Source:

			Action	DRS
		Other

Items per page:

1 - 1 of 1

Similar Datasets

Transcription profiling of zebrafish embryos following cardiac troponin T2 knockdown

Project description:We examined the transcriptional effect of preventing cardiac contraction in zebrafish embryos which can be deprived of circulation without experiencing hypoxia since the fish obtain sufficient oxygen via diffusion. Morpholino antisense knockdown of cardiac troponin T2 (tnnt2) prevented cardiac contraction without affecting vascular development. We concluded that absence of hemodynamic force induces endothelial CXCR4a up-regulation and promotes recovery of blood flow. We used microarrays to define the genetic signatures of the development of collateral vessels in zebrafish. Experiment Overall Design: One cell zebrafish embryos were injected with morpholino antisense against control or cardiac troponin t2, which prevents cardiac development. Whole embryo RNA was extracted at 36, 48, and 60h post fertilization and transcriptionally profiled.

2009-07-05 | E-GEOD-16740 | biostudies-arrayexpress

Danio rerio

Project description:The effect of cardiac troponin T2 knockdown on gene expression in zebrafish embryos

| PRJNA117435 | ENA

Transcriptional profiling of embryonic zebrafish expressing a mutant TNNT2

Project description:Transcriptional profiling of embryonic zebrafish injected with a control morpholino or a morpholino that causes exclusion of TNNT2 exon 13. Zebrafish embryos were injected with a antisense morpholino oligo that induced missplicing of exon 13 of TNNT2 (TNNT2sp) or a control morpholino. At 96hpf these embryos were euthanized and RNA was collected.

2010-12-31 | E-GEOD-20179 | biostudies-arrayexpress

Knockdown of slc2a10/glut10 in zebrafish embryos vs. controls

Project description:A zebrafish model of arterial tortuosity syndrome (ATS) was generated by knocking down the slc2a10/glut10 gene using antisense morpholino oligonucleotides (MO). Control morpholino treated embryos were used as controls. The samples were collected for gene expression profiling at 48 hours post fertilization. Experimental details and analyzed data are available in Willaert et al. Human Molecular Genetics 2011; doi: 10.1093/hmg/ddr555

2011-12-17 | GSE34508 | GEO

Parallel genetic excisions of the cardiac troponin I N-terminal extension in tachycardic mammals

Project description:A study of cardiac troponin I evolution in mammals with high heart rates, including shrews, moles, and bats. With genomic, mRNA and protein level analyses we showed repeated loss of the N-terminal extension. Here, liquid chromatography with tandem mass spectrometry was used to verify cardiac troponin I (TNNI3) protein identity in ∼22 kDa bands from Pyrenean desman (Galemys pyrenaicus) and northern short-tailed shrew (Blarina brevicauda) hearts.

2024-07-19 | PXD048600 | Pride

Identification of differentially-expressed genes between FoxH1 morpholino and control in zebrafish embryos.

Project description:The Forkhead Box H1 (FoxH1) protein is a co-transcription factor recruited by phosphorylated Smad2 downstream of several TGFbetas, including Nodal-related proteins. We have reassessed the function of zebrafish FoxH1 using antisense morpholino oligonucleotides (MOs) ( 5’ TGCTTTGTCATGCTGATGTAGTGGG 3’) as compared with a control morpholino (MO) with no specific target (5’ TAGTTAAGCCTAGCTCTCATAAACT 3’). Probing FoxH1 morphant RNA by microarray, we identified a cohort of five keratin genes – cyt1, cyt2, krt4, krt8 and krt18 - that are normally transcribed in the embryo’s enveloping layer (EVL) and which have significantly reduced expression in FoxH1-depleted embryos. Keywords: 40% epiboly-stage embryos, injected with either 8 ng of a 25mer morpholino (MO) with no specific target or 8 ng of a 25mer MO with reverse complementary to the 5’ untranslated region of the zebrafish foxH1 gene.

2007-07-30 | GSE8076 | GEO

Autophagy is essential for cardiac morphogenesis during vertebrate development

Project description:This study examined the effects of genetic knockdown of autophagy genes on vertebrate cardiac development We performed microarray studies comparing the hearts of control zebrafish embryos to the hearts of embryos with decreased expression of the autophagy genes atg5, becn1 or atg7. The results provide insight into the role of autophagy in developmental morphogenesis. Hearts were purified from 3 day-old zebrafish embryos injected with control or autophagy gene-specific morpholino oligonucleotides. RNA was prepared from all samples and hybridized to zebrafish-specific Affymetricx arrays.

2014-03-01 | E-GEOD-51541 | biostudies-arrayexpress

Zebrafish embryos: hdac1 Morphants vs Standard control morphants

Project description:Transcriptional profiling of hdac1 morphant zebrafish embryos in comparison to standard control injected embryos. Embryos where injected at the one cell stage with either a translation blocking morpholino (Hdac1 ATG), splice blocking morpholino (Hdac1 Splice) or Hdac1 mismatch control morpholino (Hdac1 control). RNA was extracted and compared in a two-colour hybridisation to the comman reference Standard control morpholino injected embryos.

2011-01-21 | GSE26708 | GEO

Transcription profiling of wild type wild type ,TnT transgenic for human Troponin ( non mutated), T10 transgenic for human truncated Troponin

Project description:WT wild type ,TnT transgenic for human Troponin ( non mutated), T10 transgenic for human truncated Troponin

2003-05-22 | E-RZPD-6 | biostudies-arrayexpress

Enterobacter sp. T2 strain:T2

Project description:Enterobacter sp. T2 strain:T2 Genome sequencing

| PRJNA604930 | ENA