Project description:Prostate of SD rats was injected with 0.1 ml 1% carrageenan to induce chronic nonbacterial prostatitis, and the control rats injected with sterile saline. Then, the cecal contents were collected for 16S rDNA sequencing.
2021-07-07 | GSE179639 | GEO
Project description:16s rDNA amplicon sequencing of TLR1KO and TLR1Het cecum contents and colon tissue
Project description:Here, we used reverse-phase liquid chromatography-coupled tandem mass spectrometry to study the pre-weaned lamb proteome and metaproteome in ten different gastrointestinal tracts: rumen, reticulum, omasum, abomasum, duodenum, jejunum, ileum, cecum, colon, and rectum.
Project description:Digesta and mucosa samples from stomach, jejunum, ileum, cecum and colon of the porcine GIT from four animals were analysed by metaproteomics to obtain a deeper insight into the functions of bacterial groups with a concomitant analyses of host proteins.
Project description:Eriocitrin, found in lemon fruit, has shown a wide range of biological properties. Herein, to evaluate the intestinal metabolic profile of eriocitrin in colon, the flavonoids in mice colon contents were identified by ultra performance liquid chromatography-electrospray ionization-tandem mass spectrometry (UPLC-ESI-MS/MS), and a total of 136 flavonoids were found, including eriocitrin and its six metabolites (eriodictyol, homoeriodictyol, hesperetin, eriodictyol-3'-O-glucoside, hesperetin-7-O-glucoside and eriodictyol-7-O-(6''-O-galloyl) glucoside). Mice colon contents were used for 16S rDNA gene sequencing and gas chromatography-mass (GC-MS). Resultu showed that eriocitrin significantly alters the beta diversity of the gut microbiota, the probiotics such as Lachnospiraceae_UCG_006 were significantly enriched, and the production of butyrate, valerate and hexanoate in the colon pool of short-chain fatty acids (SCFAs) were significant increased. The spearman's association analysis performed some intestinal bacteria may be involved in the metabolism of eriocitrin. Collectively, our results preliminarily suggesting the metabolism of eriocitrin in the gut, demonstrate alterations of eriocitrin on gut microbiota, which warrants further investigation to determine its potential use in food and biomedical applications.
Project description:We report the use of high-throughput sequencing technology to detect the microbial composition and abundance of mice grastic contents before and after Helicobacter pylori infection or Lactobacillus paracasei ZFM54 pretreatment/treatment. The genomic DNA was obtained by the QIAamp PowerFecal DNA Kit. Then, the DNA samples were sent to BGI Genomics Co., Ltd. (Shenzhen, China) for V3-V4 region of the 16S rRNA gene high-throughput sequencing with an Illumina MiSeq platform. DNA samples were sequenced using primers 338F (forward primer sequence ACTCCTACGGGAGGCAGCAG)-806R (reverse primer sequence GGACTACHVGGGTWTCTAAT). The sequencing analyses were carried out using silva138/16s database as a reference for the assignation of Amplicon Sequence Variant (ASV) at 100% similarity.
2022-07-27 | GSE208665 | GEO
Project description:16S rDNA High throughput sequencing of soil
| PRJNA638003 | ENA
Project description:16S rDNA High throughput sequencing of soil
Project description:We compared the microbiota of paired mouse caecal contents and faeces by applying a multi-omic approach, including 16S rDNA sequencing, shotgun metagenomics, and shotgun metaproteomics. The aim of the study was to verify whether faecal samples are a reliable proxy for the mouse colonic luminal microbiota, as well as to identify changes in taxonomy and functional activity between caecal and faecal microbial communities, which have to be carefully considered when using stool as sample for mouse gut microbiota investigations.
