Browse
Submit Data
Databases
API
Help

Dataset Information

0 Views

0 Connections

0 Citations

0 Reanalyses

0 Downloads

Omics score: 0

ABSTRACT: Archaeal 16S v4 amplicon

PROVIDER: PRJNA1134647 | ENA |

REPOSITORIES: ENA

ACCESS DATA

Json Xml

Dataset's files

Source:

			Action	DRS
	SRR29842700_1.fastq.gz	Fastqsanger.gz
	SRR29842700_2.fastq.gz	Fastqsanger.gz
	SRR29842701_1.fastq.gz	Fastqsanger.gz
	SRR29842701_2.fastq.gz	Fastqsanger.gz
	SRR29842702_1.fastq.gz	Fastqsanger.gz

Items per page:

1 - 5 of 36

Similar Datasets

Hhigh-throughput sequencing of in vitro fecal fermentation samples

Project description:We report the use of high-throughput sequencing technology to detect the microbial composition and abundance of mice grastic contents before and after Helicobacter pylori infection or Lactobacillus paracasei ZFM54 pretreatment/treatment. The genomic DNA was obtained by the QIAamp PowerFecal DNA Kit. Then, the DNA samples were sent to BGI Genomics Co., Ltd. (Shenzhen, China) for V3-V4 region of the 16S rRNA gene high-throughput sequencing with an Illumina MiSeq platform. DNA samples were sequenced using primers 338F (forward primer sequence ACTCCTACGGGAGGCAGCAG)-806R (reverse primer sequence GGACTACHVGGGTWTCTAAT). The sequencing analyses were carried out using silva138/16s database as a reference for the assignation of Amplicon Sequence Variant (ASV) at 100% similarity.

2022-07-27 | GSE208665 | GEO

7a75f7bd-831c-4b1a-9a69-e36963fb9e78 - samples

Project description:Amplicon sequencing from 45 samples - Amplicons of 16s v3-v4

| EGAD00001005027 | EGA

Project description:Microbial eukaryotic 18S V4 amplicon and prokaryotic 16S V4 amplicon

| PRJNA777784 | ENA

food fermentation metagenome

Project description:16S V3-V4 amplicon sequencing

| PRJDB9082 | ENA

Project description:Microbial prokaryotic 16S V4 amplicon and microbial eukaryotic 18S V4 amplicon

| PRJNA848776 | ENA

Targeting the treponemal microbiome of digital dermatitis infections by deep coverage pyrosequencing

Project description:We examined 36 biopsies taken from digital dermatitis lesions of Holstein cows. The target was the V3 -V4 variable region of 16S rRNA using Treponema specific primers. We identified 20 different taxa of Treponema using this approach.

2013-06-25 | GSE42426 | GEO

LC-MS/MS of autotrophic culture BP, that performs nitrate reduction coupled to iron(II) oxidation (NDFO)

Project description:Nitrate-reducing iron(II)-oxidizing (NDFO) bacteria are widespread in the environment contribute to nitrate removal and influence the fate of the greenhouse gases nitrous oxide and carbon dioxide. The autotrophic growth of nitrate-reducing iron(II)-oxidizing bacteria is rarely investigated and poorly understood. The most prominent model system for this type of studies is enrichment culture KS, which originates from a freshwater sediment in Bremen, Germany. A second NDFO culture, culture BP, was obtained with a sample taken in 2015 at the same pond and cultured in a similar way. To gain insights in the metabolism of nitrate reduction coupled to iron(II) oxidation under in the absence of organic carbon and oxygen limited conditions, we performed metagenomic, metatranscriptomic and metaproteomic analyses of culture BP. Raw sequencing data of 16S rRNA amplicon sequencing (V4 region with Illumina and near full-length with PacBio), shotgun metagenomics, metagenome assembly, raw sequencing data of shotgun metatranscriptomes (2 conditions, triplicates) can be found at SRA in https://www.ncbi.nlm.nih.gov/bioproject/PRJNA693457. This dataset contains proteomics data for 2 conditions in triplicates. Samples R23, R24, and R25 are grown in autotrophic conditions, samples R26, R27, and R28 in heterotrophic conditions.

2021-05-17 | PXD023710 | Pride

Project description:16S v4-v5 amplicon sequencing AD bioreactor

| PRJNA885972 | ENA

Project description:V3-V4 16S rRNA Amplicon based Sequencing.

| PRJNA915108 | ENA

Project description:V3-V4 16S rRNA Amplicon based Sequencing.

| PRJNA915093 | ENA