Project description:Dual-color transcriptional profiling of decoy-transfected cells, harboring AAAA[AGT]TT motif, versus scrambled-transfected cells as controls.
2009-11-04 | GSE18844 | GEO
Project description:Decoy vs Scrambled and siRNA vs Mock Transfected MBA-MD-231 Cell Line
Project description:Transcriptional profiling of MDA-MB-231 comparing the regulatory consequences of transfecting synthetic decoys carring sRSM1 motifs versus synthetic scrambled oligos Two decoy/scrambled sets, each with two biological replicates
Project description:Single-stranded oligos listed below (and the corresponding reverse compliment) were synthesized and annealed: E2F: CTAGATTTCCCGCGGATC (decoy); CTAGACTCTGCTCGGATC (scrambled) KTGGYRSGAA: CTAGATTCCCGCCAAGGATC (decoy); CTAGACAGCTACTCCGGATC (scrambled) TGCGCANK: CTAGACATGCGCAGGATC (decoy); CTAGATCACAGGCGGATC (scrambled) CCAATNNSNNNGCG: CTAGACGCCCTCCGATTGGGGATC (decoy); CTAGATGCACGCTCGGTCCGGATC (scrambled) ACTWSNACTNY: CTAGAGGAGTTGTAGTGGATC (decoy); CTAGAGATAGTGTGTGGGATC (scrambled) HeLa cells were propagated in DMEM (Invitrogen) plus 10% FBS and transfected with 0.5 uM of double-stranded DNA. Total RNA was extracted with TRIzol (Invitrogen) from HeLa cells 2 d after transfection of the indicated decoy oligo or scrambled oligo in duplicate. RNA was amplified using the Ambion Amino Allyl MessageAmp II aRNA kit. For each motif, decoy oligo transfected samples (labeled with Cy5) and the corresponding scrambled oligo transfected samples (labeled with Cy3) were competitively hybridized to HEEBO microarrays as described (http://www.microarray.org/sfgf/heebo.do).
Project description:Single-stranded oligos listed below (and the corresponding reverse compliment) were synthesized and annealed: E2F: CTAGATTTCCCGCGGATC (decoy); CTAGACTCTGCTCGGATC (scrambled) KTGGYRSGAA: CTAGATTCCCGCCAAGGATC (decoy); CTAGACAGCTACTCCGGATC (scrambled) TGCGCANK: CTAGACATGCGCAGGATC (decoy); CTAGATCACAGGCGGATC (scrambled) CCAATNNSNNNGCG: CTAGACGCCCTCCGATTGGGGATC (decoy); CTAGATGCACGCTCGGTCCGGATC (scrambled) ACTWSNACTNY: CTAGAGGAGTTGTAGTGGATC (decoy); CTAGAGATAGTGTGTGGGATC (scrambled) HeLa cells were propagated in DMEM (Invitrogen) plus 10% FBS and transfected with 0.5 uM of double-stranded DNA. Total RNA was extracted with TRIzol (Invitrogen) from HeLa cells 2 d after transfection of the indicated decoy oligo or scrambled oligo in duplicate. RNA was amplified using the Ambion Amino Allyl MessageAmp II aRNA kit. For each motif, decoy oligo transfected samples (labeled with Cy5) and the corresponding scrambled oligo transfected samples (labeled with Cy3) were competitively hybridized to HEEBO microarrays as described (http://www.microarray.org/sfgf/heebo.do). genetic_modification_design
Project description:Targeted interference of sin3a-tgif1 function by SID decoy treatment inhibits WNT signaling and invasion in triple negative breast cancer cells. MDA-MB-231 cells were treated with scrambled SID control, 2.5µM SID peptide or untreated for 24h. Sub-confluent cultures of MDA-MB-231 cells were treated with scrambled SID control, 2.5µM SID peptide or untreated for 24h. Experiments were performed as three independent replicates.
Project description:Targeted interference of sin3a-tgif1 function by SID decoy treatment inhibits WNT signaling and invasion in triple negative breast cancer cells. MDA-MB-231 cells were treated with scrambled SID control, 2.5µM SID peptide or untreated for 24h.
Project description:Alternative splicing, a fundamental step in gene expression, is deregulated in many diseases. Splicing factors (SFs), which regulate this process, are up- or down regulated or mutated in several diseases including cancer. To date, there are no inhibitors that directly inhibit the activity of SFs. We designed decoy oligonucleotides, composed of several repeats of a RNA motif, which is recognized by a single SF. Here we show that decoy oligonucleotides targeting splicing factors RBFOX1/2, SRSF1 and PTBP1, can specifically bind to their respective SFs and inhibit their splicing and biological activities both in vitro and in vivo. These decoy oligonucleotides present a novel approach to specifically downregulate SF activity and have the potential to treat diseases where SFs are up-regulated, such as cancer.
Project description:Transcriptional profiling of MDA-MB-231 comparing the regulatory consequences of transfecting synthetic decoys carring sRSM1 motifs versus synthetic scrambled oligos
