Ontology highlight
ABSTRACT:
PROVIDER: PRJNA658607 | ENA |
REPOSITORIES: ENA
Dataset's files
| Action | DRS | |||
|---|---|---|---|---|
| SRR12494336.fastq.gz | Fastqsanger.gz | |||
| SRR12494337.fastq.gz | Fastqsanger.gz | |||
| SRR12494338.fastq.gz | Fastqsanger.gz | |||
| SRR12494339.fastq.gz | Fastqsanger.gz | |||
| SRR12494340.fastq.gz | Fastqsanger.gz |
Items per page: 5 1 - 5 of 48 |
Similar Datasets
Project description:RNA-seq to determine alterations in gene expression and in alternative splicing events in cells where the PTBP1 gene was mutated by CRISPR/Cas9 technology causing resistance to CDC7 kinase inhibitor.
2023-05-22 | E-MTAB-12578 | biostudies-arrayexpress
Project description:<p>Due to the paucity of patient derived models in rare cancers, identification of therapeutic targets remains challenging. We developed a patient derived model, CLF-PED-015-T, from a patient with an undifferentiated sarcoma. From this model, we performed pooled RNAi and CRISPR-Cas9 negative selection screens and integrated that with a small molecule screen. Integration of these data identified CDK4 and XPO1 as potential therapeutic targets.</p>
| phs001121 | dbGaP
Project description:<p>We derived faithful cancer cell lines from patients with a diagnosis of renal medullary carcinomas (RMC). These models have been sequenced with whole genome, exome and transcriptome technologies along with the patient's primary germline and tumor samples. We took these faithful models and performed loss-of-function genetic perturbation screens (e.g. RNAi and CRISPR-Cas9) along with an orthogonal small molecule screen. We identified the ubiquitin-proteasome system as an important target in RMC as well as other SMARCB1 deficient cancers.</p>
| phs001800 | dbGaP
Project description:Recurrent mutations in calreticulin (CALR) are present in 70-80% of JAK2 unmutated myeloproliferative neoplasms (MPN). Current models of CALR mutant MPNs are mainly based on cancer cell lines with ectopic overexpression or transgenic mouse models with a lack of data for primary human hematopoietic stem and progenitor cells (HSPCs) with endogenous CALR expression. Thus, we developed a CRISPR/Cas9 and AAV6-mediated knock-in approach to introduce the two most common CALR mutations (52 bp deletion, DEL; 5 bp insertion, INS) at the endogenous gene locus in human cord blood-derived HSPCs. We used these cells to investigate transcriptional changes induced upon CALR mutation acquisition in HSPCs in a prospective manner by performing RNA-sequencing 4 days after CRISPR-mediated knock-in.
2023-01-09 | GSE195705 | GEO
Project description:Noncoding RNAs (ncRNAs) comprise an important class of natural regulators that mediate a vast array of biological processes, including the modulation of chromatin architecture. Moreover, artificial ncRNAs have revealed that the functional capabilities of RNA are extremely broad. To further investigate and harness these capabilities, we developed CRISPR-Display ("CRISP-Disp"), a targeted localization strategy that uses Cas9 to deploy large RNA cargos to specific DNA loci. We demonstrate that exogenous RNA domains can be functionally appended onto the CRISPR scaffold at multiple insertion points, allowing the construction of Cas9 complexes with RNAs nearing one kilobase in length, with structured RNAs, protein-binding cassettes, artificial aptamers and pools of random sequences. CRISP-Disp also allows the simultaneous multiplexing of disparate functions at multiple targets. We anticipate that this technology will provide a powerful method with which to ectopically localize functional RNAs and ribonuceloprotein complexes at specified genomic loci. RNA Immunoprecipitation (RIP) against FLAG-tagged Cas9 protein, coexpressed with a large pool of CRISPR RNAs bearing random internal insertions
2015-05-11 | E-GEOD-62305 | biostudies-arrayexpress
Project description:Provided data came from a detailed study on Nicotiana benthamiana 16c plants where we use Tobacco Rattle Virus (TRV) as a molecular switch to change the chromatin state of a reporter gene (P35S::GFP) from an actively transcribed to a transcriptionally silenced state. Our approach enables us to interrogate different chromatin states of the same locus with the same set of CRISPR/Cas9 genome editing reagents and systematically describe the effect of chromatin state on the frequency and type of mutations induced at various Cas9 targets in a huge set of independently edited cells.
2022-05-04 | E-MTAB-10256 | biostudies-arrayexpress
Project description:To uncover, in an unbiased fashion, which elements of the 18 kb translocated region control EVI1 transcription, we devised a CRISPR/Cas9-based enhancer scanning approach. We considered all possible sgRNA target sites containing a canonical Cas9 PAM site (NGG) on both strands of the minimal 18 kb translocated region. Deep-sequencing libraries were generated by PCR amplification of sgRNA guide strands using primers that tag the product with standard Illumina adapters and a 4 bp sample barcode in a 2 step-PCR protocol.
2021-07-26 | E-MTAB-9948 | biostudies-arrayexpress
Project description:Understanding the impact of guide RNA (gRNA) and genomic locus on CRISPR/Cas9 activity is crucial to design effective gene editing assays. However, it is challenging to profile Cas9 activity in the endogenous cellular environment. We leverage our TRIP technology to integrate ~1k barcoded reporter genes in the genomes of mouse embryonic stem cells. We target the integrated reporters (IRs) using RNA-guided Cas9 and characterize induced mutations by sequencing. We report that gRNA-sequence and IR locus explain most variation in mutation efficiency. Predominant insertions of a gRNA-specific nucleotide are consistent with template-dependent repair of staggered DNA ends with 1-bp 5′ overhangs. We confirm that such staggered ends are induced by Cas9 in mouse pre-B cells. To explain observed insertions, we propose a model generating primarily blunt and occasionally staggered DNA ends. Mutation patterns indicate that gRNA-sequence controls the fraction of staggered ends, which could be used to optimize Cas9-based insertion efficiency.
2019-03-08 | GSE127752 | GEO
Project description:Clustered regularly interspaced short palindromic repeat (CRISPR) RNA-guided nucleases have gathered considerable excitement as a tool for genome engineering. However, questions remain about the specificity of their target site recognition. Most previous studies have examined predicted off-target binding sites that differ from the perfect target site by one to four mismatches, which represent only a subset of genomic regions. Here, we used ChIP-seq to examine genome-wide CRISPR binding specificity at gRNA-specific and gRNA-independent sites. For two guide RNAs targeting the murine Snurf gene promoter, we observed very high binding specificity at the intended target site while off-target binding was observed at 2- to 6-fold lower intensities. We also identified significant gRNA-independent off-target binding. Interestingly, we found that these regions are highly enriched in the PAM site, a sequence required for target site recognition by CRISPR. To determine the relationship between Cas9 binding and endonuclease activity, we used targeted sequence capture as a high-throughput approach to survey a large number of the potential off-target sites identified by ChIP-seq or computational prediction. A high frequency of indels was observed at both target sites and one off-target site, while no cleavage activity could be detected at other ChIP-bound regions. Our results demonstrate that even a simple configuration of a Cas9:gRNA nuclease can support very specific DNA cleavage activity and that most interactions between the CRISPR nuclease complex and genomic PAM sites do not lead to DNA cleavage. ChIP-seq using dCas9 to determine genome-wide binding of CRISPR/Cas9 noED: Cas9 doublemutant protein without an effector domain KRAB: Cas9 doublemutant protein fused to the KRAB repressor domain S1 gRNA: guide RNA targeting GCTCCCTACGCATGCGTCCC(AGG) in the mouse genome S2 gRNA: guide RNA targeting AATGGCTCAGGTTTGTCGCG(CGG) in the mouse genome VEGFA TS3 gRNA: guide RNA targeting GGTGAGTGAGTGTGTGCGTG(TGG) in the human genome
2015-03-04 | E-GEOD-61099 | biostudies-arrayexpress