Ontology highlight
ABSTRACT:
PROVIDER: PRJNA905424 | ENA |
REPOSITORIES: ENA
Similar Datasets
Project description:Quantitative monitoring of environmental DNA using high-throughput sequencing
| PRJDB5570 | ENA
Project description:DNA aptamers and framework DNA nanostructures are emerging DNA materials with many appealing biological applications including biosensing, bioimaging, drug delivery etc. When placed in physiological fluids, they inevitably encounter biomolecules (majorly proteins) and form complexes that largely affects their biological fate. Nevertheless, little is known regarding the quantitative profile of proteins that adsorb to DNA aptamers and DNA nanostructures in biological environments, and there are no potent strategies to regulate protein profiles. Herein, we performed a proteomic analysis to profile proteins that bind to DNA aptamers (Sgc8c and SYLC3) and nanostructures (a tetrahedral DNA nanostructure and a DNA origami rod) in human serum by using liquid chromatography mass spectrometry (LC-MS).
2021-05-15 | MSV000087433 | MassIVE
Project description:Here, we report an ssDNA aptamer with high specificity and affinity towards Salmonella paratyphi A generated using the whole-cell SELEX process. The aptamers generated against an organism show salient features, such as higher affinity than existing antibodies, and are highly specific towards the targeted organism. Thus, the generated aptamer sequences can serve as potential biomarkers for the onsite detection of pathogens with high specificity and sensitivity. Molecular dynamics simulation was used to model the linear chain of the aptamers to a three-dimensional conformation, and the binding mechanism against DNA gyrase was established.
2019-12-31 | GSE137006 | GEO
Project description:We report high-affinity ssDNA aptamers as biomarkers and antagonists of amyloid-β peptide. We generated three novel aptamer sequences from the pool of aptamers through the SELEX process, and evaluated their affinity and sensitivity using enzyme-linked immunosorbent assay (ELISA). (The forward primer: ATTAGTCAAGAGGTAGACGCACATA, reverse primer TTCTGGTCGTCGTGACTCCTAT) The ssDNA aptamers modeled into a three-dimensional structure; interaction and mechanism of action derived through molecular dynamics simulations (MD). MD simulations revealed the nature of binding and inhibition of aggregation by binding with amyloid-β peptide monomers, dimers, and other oligomers. The presence of high non-bonded interaction energy along with hydrogen bonds constitutes the complex structure of the aptamer-amyloid-β peptide. Furthermore, the changes in the secondary structure induced by aptamers may help remove the peptide through the blood-brain barrier. This study provided a framework for the application of aptamers against amyloid-β peptides as biomarkers and antagonists.
2019-09-30 | GSE124865 | GEO
Project description:Cancer biomarker discovery constitutes a frontier in cancer research. In recent years, cell-binding aptamers have become useful molecular probes for biomarker discovery. However, there are few successful examples, and the critical barrier resides in the identification of the cell-surface protein targets for the aptamers, where only a limited number of aptamer targets have been identified so far. Herein, we developed a universal SILAC-based quantitative proteomic method for target discovery of cell-binding aptamers. The method allowed for distinguishing specific aptamer-binding proteins from non-specific proteins based on abundance ratios of proteins bound to aptamer-carrying bait and control bait. In addition, we employed fluorescently labeled aptamers for monitoring and optimizing the binding conditions. We were able to identify and validate selectin L and integrin 4 as the protein targets for two previously reported aptamers, Sgc-3b and Sgc-4e, respectively. This strategy should be generally applicable for the discovery of protein targets for other cell-binding aptamers, which will promote the applications of these aptamers.
2022-02-28 | PXD002480 | Pride
Project description:Regulation of gene expression is essential for normal development and cellular growth. Transcriptional events are tightly controlled both spatially and temporally by specific DNA-protein interactions. In this study we finely map the genome-wide targets of the CREB protein across all known and predicted human promoters, and characterize the functional consequences of a subset of these binding events using high-throughput reporter assays. To measure CREB binding, we used HaloCHIP, an antibody-free alternative to the ChIP method that utilizes the HaloTag fusion protein, and also high-throughput promoter-luciferase reporter assays, which provide rapid and quantitative screening of promoters for transcriptional activation or repression in living cells.
2009-10-01 | GSE18347 | GEO
Project description:Differential binding cell-SELEX: method for identification of cell specific aptamers by high throughput sequencing
| PRJEB28303 | ENA
Project description:Differential binding cell-SELEX: method for identification of cell specific aptamers by high throughput sequencing
| PRJEB28411 | ENA
Project description:Accurate predictions of the DNA binding specificities of transcription factors (TFs) are necessary for understanding gene regulatory mechanisms. Traditionally, predictive models are built based on nucleotide sequence features. Here, we employed three- dimensional DNA shape information obtained on a high-throughput basis to integrate intuitive DNA structural features into the modeling of TF binding specificities using support vector regression. We performed quantitative predictions of DNA binding specificities, using the DREAM5 dataset for 65 mouse TFs and genomic-context protein binding microarray data for three human basic helix-loop-helix TFs. DNA shape-augmented models compared favorably with sequence-based models for these predictions. Although both k-mer and DNA shape features encoded the interdependencies between nucleotide positions of the binding site, using DNA shape features reduced the dimensionality of the feature space compared to k-mer use. Finally, analyzing the weights of DNA shape-augmented models uncovered TF family- specific structural readout mechanisms that were not obvious from the nucleotide sequence.
2014-11-04 | GSE59845 | GEO
Project description:Thromboembolic diseases are commonly associated with thrombus-induced ischemia and tissue damage; identification of the location of the thrombus, or thrombus-targeting, may facilitate diagnosis and target therapy. We hypothesized that aptamers with high affinity and specificity for coagulation factor XIII (FXIII) can serve as thrombus-targeting probes. With systematic evolution of ligands by exponential enrichment technology and semi-activated FXIII (FXIII’) as the target, guanine-rich FXIII’-binding aptamers (FAs; 76 nt) were selected from a library of single-stranded DNA. Next generation sequencing identified FAs with the highest frequency; bio-layer interferometry revealed a dissociation constant (Kd) from 0.7 to 2.5 nM. Truncation with preservation of a conserved region based on entropy analysis resulted in three truncated FAs (FATs; 41-47 nt) that exhibited 4-fold signal in binding to activated vs. resting platelets, as determined by flowcytometry. In addition, FAT2 exhibited up to 4.2-fold binding of that from scrambled ssDNA to platelet/fibrin clot or whole blood clot in vitro, suggesting binding to both activated plateltes and fibrin. FAT2 also exhibited targeting effects in a microcirculatory thrombosis model in mice. Nevertheless, FATs induced no effect on blood coagulation, as determined by thromboelastometry. In conclusion, FXIII-binding aptamers are potentially amenable to thrombus targeting in theranostic application of thromboembolic diseases.
2023-12-28 | GSE163934 | GEO