Ontology highlight
ABSTRACT:
PROVIDER: PRJNA988934 | ENA |
REPOSITORIES: ENA
Dataset's files
| Action | DRS | |||
|---|---|---|---|---|
| SRR25178453.fastq.gz | Fastqsanger.gz | |||
| SRR25178454.fastq.gz | Fastqsanger.gz | |||
| SRR25178455.fastq.gz | Fastqsanger.gz | |||
| SRR25178456.fastq.gz | Fastqsanger.gz | |||
| SRR25178457.fastq.gz | Fastqsanger.gz |
Items per page: 5 1 - 5 of 18 |
Similar Datasets
Project description:Mitochondrial rRNAs play important roles in regulating mtDNA-encoded gene expression and energy metabolism subsequently. However, the proteins that regulate mitochondrial 16S rRNA processing remain poorly understood. Herein, we generated adipose-specific Wbscr16-/- mice and cells, both of which exhibited dramatic mitochondrial changes. Subsequently, WBSCR16 was identified as a 16S rRNA-binding protein essential for the cleavage of 16S rRNA-mt-tRNALeu, facilitating 16S rRNA processing and mitochondrial ribosome assembly. Additionally, WBSCR16 recruited RNase P subunit MRPP3 to nascent 16S rRNA and assisted in this specific cleavage. Furthermore, evidence showed that adipose-specific Wbscr16 ablation promotes energy wasting via lipid preference in brown adipose tissue, leading to excess energy expenditure and resistance to obesity. In contrast, overexpression of WBSCR16 upregulated 16S rRNA processing and induced a preference for glucose utilization in both transgenic mouse models and cultured cells. These findings suggest that WBSCR16 plays essential roles in mitochondrial 16S rRNA processing in mammals, and is the key mitochondrial protein to balance glucose and lipid metabolism.
2024-12-30 | GSE229693 | GEO
Project description:To explore the effects of gut microbiota of young (8 weeks) or old mice (18～20 months) on stroke, feces of young (Y1-Y9) and old mice (O6-O16) were collected and analyzed by 16s rRNA sequencing. Then stroke model was established on young mouse receive feces from old mouse (DOT1-15) and young mouse receive feces from young mouse (DYT1-15). 16s rRNA sequencing were also performed for those young mice received feces from young and old mice.
2021-10-15 | E-MTAB-10837 | biostudies-arrayexpress
Project description:Colon cancer is a major cause of cancer deaths in Western countries and is associated with diets high in red meat. Heme, the iron-porphyrin pigment of red meat, induces cytotoxicity of gut contents which injures surface cells leading to compensatory hyperproliferation of crypt cells. This hyperproliferation results in epithelial hyperplasia which increases the risk of colon cancer. In humans, a high red-meat diet increases Bacteroides spp in feces. Therefore, we simultaneously investigated the effects of dietary heme on colonic microbiota and on the host mucosa of mice. Whole genome microarrays showed that heme injured the colonic surface epithelium and induced hyperproliferation by changing the surface to crypt signaling. Using 16S rRNA phylogenetic microarrays, we investigated whether bacteria play a role in this changed signaling. Heme increased Bacteroidetes and decreased Firmicutes in colonic contents. This shift was most likely caused by a selective susceptibility of Gram-positive bacteria to heme cytotoxic fecal water, which is not observed for Gram-negative bacteria, allowing expansion of the Gram-negative community. The increased amount of Gram-negative bacteria most probably increased LPS exposure to colonocytes, however, there is no appreciable immune response detected in the heme-fed mice. There was no functional change in the sensing of the bacteria by the mucosa, as changes in inflammation pathways and Toll- like receptor signaling were not detected. This unaltered host-microbe cross-talk indicates that the changes in microbiota did not play a causal role in the observed hyperproliferation and hyperplasia. Keywords: Expression profiling by array Mice were fed a Westernized high fat control diet, or the same diet supplemented with 0.5 M-BM-5mol heme/g diet. After 14 days of intervention, mice were killed and gene expression was profiled in colon.
2012-12-19 | E-GEOD-40672 | biostudies-arrayexpress
Project description:We report the use of high-throughput sequencing technology to detect the microbial composition and abundance of mice grastic contents before and after Helicobacter pylori infection or Lactobacillus paracasei ZFM54 pretreatment/treatment. The genomic DNA was obtained by the QIAamp PowerFecal DNA Kit. Then, the DNA samples were sent to BGI Genomics Co., Ltd. (Shenzhen, China) for V3-V4 region of the 16S rRNA gene high-throughput sequencing with an Illumina MiSeq platform. DNA samples were sequenced using primers 338F (forward primer sequence ACTCCTACGGGAGGCAGCAG)-806R (reverse primer sequence GGACTACHVGGGTWTCTAAT). The sequencing analyses were carried out using silva138/16s database as a reference for the assignation of Amplicon Sequence Variant (ASV) at 100% similarity.
2022-07-27 | GSE208665 | GEO