Browse
Submit Data
Databases
API
Help

Dataset Information

0 Views

0 Connections

0 Citations

0 Reanalyses

0 Downloads

Omics score: 0

ABSTRACT: 16S rRNA of luminal contents in mouse

PROVIDER: PRJNA882633 | ENA |

REPOSITORIES: ENA

ACCESS DATA

Json Xml

Dataset's files

Source:

			Action	DRS
	SRR21689265_1.fastq.gz	Fastqsanger.gz
	SRR21689265_2.fastq.gz	Fastqsanger.gz
	SRR21689266_1.fastq.gz	Fastqsanger.gz
	SRR21689266_2.fastq.gz	Fastqsanger.gz
	SRR21689267_1.fastq.gz	Fastqsanger.gz

Items per page:

1 - 5 of 24

Similar Datasets

Mouse caecum vs faeces - Metaproteogenomics Reveals Taxonomic and Functional Changes between Cecal and Fecal Microbiota in Mouse

Project description:We compared the microbiota of paired mouse caecal contents and faeces by applying a multi-omic approach, including 16S rDNA sequencing, shotgun metagenomics, and shotgun metaproteomics. The aim of the study was to verify whether faecal samples are a reliable proxy for the mouse colonic luminal microbiota, as well as to identify changes in taxonomy and functional activity between caecal and faecal microbial communities, which have to be carefully considered when using stool as sample for mouse gut microbiota investigations.

2017-03-31 | PXD004911 | Pride

Project description:16S rRNA of mouse cecum contents

| PRJNA1104429 | ENA

WBSCR16 Deficiency Drives Adaptive Metabolic Flexibility Via Impaired Mitochondrial 16S rRNA Maturation

Project description:Mitochondrial rRNAs play important roles in regulating mtDNA-encoded gene expression and energy metabolism subsequently. However, the proteins that regulate mitochondrial 16S rRNA processing remain poorly understood. Herein, we generated adipose-specific Wbscr16-/- mice and cells, both of which exhibited dramatic mitochondrial changes. Subsequently, WBSCR16 was identified as a 16S rRNA-binding protein essential for the cleavage of 16S rRNA-mt-tRNALeu, facilitating 16S rRNA processing and mitochondrial ribosome assembly. Additionally, WBSCR16 recruited RNase P subunit MRPP3 to nascent 16S rRNA and assisted in this specific cleavage. Furthermore, evidence showed that adipose-specific Wbscr16 ablation promotes energy wasting via lipid preference in brown adipose tissue, leading to excess energy expenditure and resistance to obesity. In contrast, overexpression of WBSCR16 upregulated 16S rRNA processing and induced a preference for glucose utilization in both transgenic mouse models and cultured cells. These findings suggest that WBSCR16 plays essential roles in mitochondrial 16S rRNA processing in mammals, and is the key mitochondrial protein to balance glucose and lipid metabolism.

2024-12-30 | GSE229693 | GEO

16s rRNA-young and old mouse gut microbiota-stroke

Project description:To explore the effects of gut microbiota of young (8 weeks) or old mice (18～20 months) on stroke, feces of young (Y1-Y9) and old mice (O6-O16) were collected and analyzed by 16s rRNA sequencing. Then stroke model was established on young mouse receive feces from old mouse (DOT1-15) and young mouse receive feces from young mouse (DYT1-15). 16s rRNA sequencing were also performed for those young mice received feces from young and old mice.

2021-10-15 | E-MTAB-10837 | biostudies-arrayexpress

Project description:B. siamensis MZ16 ,16S rRNA of mouse colon contents

| PRJNA988934 | ENA

Project description:pig intestinal contents 16S rRNA

| PRJNA742475 | ENA

Hhigh-throughput sequencing of in vitro fecal fermentation samples

Project description:We report the use of high-throughput sequencing technology to detect the microbial composition and abundance of mice grastic contents before and after Helicobacter pylori infection or Lactobacillus paracasei ZFM54 pretreatment/treatment. The genomic DNA was obtained by the QIAamp PowerFecal DNA Kit. Then, the DNA samples were sent to BGI Genomics Co., Ltd. (Shenzhen, China) for V3-V4 region of the 16S rRNA gene high-throughput sequencing with an Illumina MiSeq platform. DNA samples were sequenced using primers 338F (forward primer sequence ACTCCTACGGGAGGCAGCAG)-806R (reverse primer sequence GGACTACHVGGGTWTCTAAT). The sequencing analyses were carried out using silva138/16s database as a reference for the assignation of Amplicon Sequence Variant (ASV) at 100% similarity.

2022-07-27 | GSE208665 | GEO

16S rRNA sequencing of cecal microbiota from neonatal mice pre- and post-weaning

Project description:Neonatal mice were susceptible to cryptosporidium infection at 1- and 2-weeks of age, but were resistant to infection at 3- and 6-weeks of age. Diet and microbial changes are known to occur during the weaning transition in mice and we hypothesized that these changes in the intestinal luminal environment might influence resistance and susceptibility to cryptosporidium infection. As one part of testing this hypothesis, cecal microbiota composition was determined by 16S ribosomal RNA sequencing of DNA isolated from the cecal contents of mice at 1 week, 2 weeks, 3 weeks, and 6 weeks of age.

2020-11-03 | E-MTAB-9100 | biostudies-arrayexpress

Analysis of gut microbiota by pyrosequencing of 16S rRNA gene in F344 rats

Project description:Chronic acid suppression by proton pump inhibitor (PPI) has been hypothesized to alter the gut microbiota via a change in intestinal pH. To evaluate the changes in gut microbiota composition by long-term PPI treatment. Twenty-four week old F344 rats were fed with (n = 5) or without (n = 6) lansoprazole (PPI) for 50 weeks. Then, profiles of luminal microbiota in the terminal ileum were analyzed. Pyrosequencing for 16S rRNA gene was performed by genome sequencer FLX (454 Life Sciences/Roche) and analyzed by metagenomic bioinformatics.

2015-04-14 | E-GEOD-67800 | biostudies-arrayexpress

Project description:Colonic contents sample 16S rRNA sequencing

| PRJNA597824 | ENA