Browse
Submit Data
Databases
API
Help

Unknown,Transcriptomics,Genomics,Proteomics

Dataset Information

33 Views

0 Connections

0 Citations

0 Reanalyses

0 Downloads

Omics score: 0

Hypoxia promotes stem cell phenotypes and poor prognosis through epigenetic regulation of DICER [HMLER]

ABSTRACT: MicroRNAs are small regulatory RNAs that post-transcriptionally control gene expression. Reduced expression of DICER, the enzyme involved in microRNA processing, is frequently observed in cancer and is associated with poor clinical outcome in various malignancies. Yet the underlying mechanisms are not well understood. Here, we identify tumor hypoxia as a regulator of DICER expression in large cohorts of breast cancer patients. We show that DICER expression is suppressed by hypoxia through an epigenetic mechanism that involves inhibition of oxygen-dependent H3K27me3 demethylases KDM6A/B and results in silencing of the DICER promoter. Subsequently, reduced miRNA processing leads to derepression of the miR-200 target ZEB1, stimulates the epithelial to mesenchymal transition and ultimately results in the acquisition of stem cell phenotypes in human mammary epithelial cells. Our study uncovers a previously unknown relationship between oxygen-sensitive epigenetic regulators, miRNA biogenesis and tumor stem cell phenotypes that may underlie poor outcome in breast cancer. A total of 12 samples were analyzed. For each condition tested, 3 independent experiments were carried out (biological repicates).

ORGANISM(S): Homo sapiens

SUBMITTER: Cindy Yao

PROVIDER: E-GEOD-61721 | biostudies-arrayexpress |

REPOSITORIES: biostudies-arrayexpress

ACCESS DATA

Json Xml

Similar Datasets

Hypoxia promotes stem cell phenotypes and poor prognosis through epigenetic regulation of DICER [MCF7]

Project description:MicroRNAs are small regulatory RNAs that post-transcriptionally control gene expression. Reduced expression of DICER, the enzyme involved in microRNA processing, is frequently observed in cancer and is associated with poor clinical outcome in various malignancies. Yet the underlying mechanisms are not well understood. Here, we identify tumor hypoxia as a regulator of DICER expression in large cohorts of breast cancer patients. We show that DICER expression is suppressed by hypoxia through an epigenetic mechanism that involves inhibition of oxygen-dependent H3K27me3 demethylases KDM6A/B and results in silencing of the DICER promoter. Subsequently, reduced miRNA processing leads to derepression of the miR-200 target ZEB1, stimulates the epithelial to mesenchymal transition and ultimately results in the acquisition of stem cell phenotypes in human mammary epithelial cells. Our study uncovers a previously unknown relationship between oxygen-sensitive epigenetic regulators, miRNA biogenesis and tumor stem cell phenotypes that may underlie poor outcome in breast cancer. miRNA profiling of MCF7 cells in normal or hypoxic conditions or after DICER knockdown in MCF7 cells.

2014-09-30 | E-GEOD-61720 | biostudies-arrayexpress

Hypoxia promotes stem cell phenotypes and poor prognosis through epigenetic regulation of DICER

Project description:This SuperSeries is composed of the SubSeries listed below. Refer to individual Series

2014-09-30 | E-GEOD-61722 | biostudies-arrayexpress

Hypoxia promotes stem cell phenotypes and poor prognosis through epigenetic regulation of DICER [HMLER]

2014-09-30 | GSE61721 | GEO

Hypoxia promotes stem cell phenotypes and poor prognosis through epigenetic regulation of DICER [MCF7]

2014-09-30 | GSE61720 | GEO

The effect of Dicer knockdown on the transcriptional expression profile of 3.10 mTEC cell line.

Project description:Dicer, also known as endoribonuclease Dicer or helicase with RNase motif, cleaves double-stranded RNA (dsRNA) and pre-microRNA (pre-miRNA) into short mature double-stranded RNA fragments called small interfering RNA and microRNA, respectively. Medullary thymic epithelial cells (mTECs) express close to 90% of the protein-coding genome, besides they play an important role to self-tolerance through the ectopic expression of peripheral tissue antigens (PTAs) in the thymus. MicroRNAs are potent post-transcriptional regulators in developmental switches, lineage commitment and gene expression regulation, but their role in representation of the immunological self in mature mTECs is not fully understood. So we used a Mus musculus mTEC cell line (mTEC 3.10) to knockdown Dicer transcript by means of siRNA transfection and then observe the effect of Dicer knockdown in the transcriptional profile of messenger RNAs (mRNAs) by means of oligo microarray hybridization. The Agilent oligo microarrays were used to determine the large scale mRNA transcriptional profiles of control or Dicer-knockdown 3.10 mTECs.

2016-06-27 | E-MTAB-4628 | biostudies-arrayexpress

The effect of Dicer knockdown on the microRNA transcriptional profile of 3.10 mTEC cell line.

2016-06-27 | E-MTAB-4627 | biostudies-arrayexpress

GIM musmusculus anti-Dicer RNAi silencing

Project description:We used the TriFectaTM (IDT, Integrated DNA Technologies,<br><br>Coralville, IA, USA) anti-Dicer RNAi sequence (AGAACGAAAUGCAAGGAAUGGACTCGAGUCCAUUCCUUGCAUUUCGUUCUUC, ACAAGAAACGGAAUCACAUCACACTAGUGUGAUGUGAUUCCGUUUCUUGUCG, GCAGUUGUCCUAAACAGAUUGAUAAUUAUCAAUCUGUUUAGGACAACUGCUG) to silencing Dicer mRNA. Confluent cultures of 3.10 mTEC cell line were transfected with 20 nM of each anti-Dicer siRNA using Hiperfect reagent (Qiagen) following manufacturerM-^Rs instructions. After transfection, cells were cultured during 24 h in RPMI medium as above mentioned and total RNA was extracted using the mirVana kit (Ambion), which served as template for cDNA synthesis. Gene knockdown was confirmed by quantitative PCR (qRT-PCR) using the primers 5M-^RCCCAAATGTAGAACCCGAGA 3M-^R forward and 5M-^RCAACCGACACTGTCCATCG 3M-^R reverse, which allowed amplification of a 119 bp PCR product corresponding to a segment of the Dicer mRNA (cDNA). Transcriptional expression levels were determined using a StepOne Real-Time PCR System (Applied Biosystems, USA).

2011-08-30 | E-MEXP-3211 | biostudies-arrayexpress

DICER-interacting partners in juvenile mouse testes

Project description:DICER has a well-characterized role in the processing of microRNAs (miRNAs) and small interfering RNAs (siRNA) that are important for post-transcriptional gene regulation. Emerging evidence suggests that DICER also has several non-canonical functions beyond miRNA/siRNA biogenesis, for example in transcriptional gene silencing at the chromatin level, as well as in RNA degradation and maintenance of genomic integrity. We have shown that the function of DICER in germ cells is essential for normal spermatogenesis; male mice lacking DICER in postnatal male germ cells are infertile due to severe defects in haploid differentiation. To better understand the function of DICER in male germ cells, we immunoprecipitated DICER from juvenile mouse testes and performed mass spectrometric analysis to identify DICER-interacting proteins.

2020-06-03 | PXD017772 | Pride

4-HNE modification of human recombinant Dicer

Project description:We used mass spectrometry analysis (nanoLC-MS/MS) to map 4-HNE-modified residues of human Dicer exposed in vitro to 4-HNE in a concentration-dependent maner

2023-11-17 | PXD034113 | Pride

Transcription profiling of human neuroblastoma cell lines grown under normoxic and hypoxic conditions

Project description:Hypoxia is a low oxygen condition that occurs in the developing tumor mass and that is associated with poor prognosis and resistance to chemo- and radio-therapy. The definition of the hypoxia gene signature is fundamental for the understanding of tumor biology, as in the case of neuroblastoma, the most common pediatric solid tumor. The issue of identifying a significant group of variables in microarray gene expression experiments is particularly difficult due to the typical high dimensional nature of the data and great effort has been spent in the development of feature selection techniques. Our main goal is to define a robust hypoxia gene signature in neuroblastoma cell lines. A set of 11 neuroblastoma cell lines were cultured under normoxic and hypoxic conditions for 18 hours, and their gene expression profiles were measured with Affymetrix GeneChip HG-U133 Plus 2.0. We used the l1-l2 regularization framework in order to select the significant probesets defining hypoxic versus normoxic cell lines. Experiment Overall Design: The expression profiles of 11 neuroblastoma cell lines under normoxia vs hypoxia were studied.

2009-10-10 | E-GEOD-17714 | biostudies-arrayexpress

OmicsDI is part of the ELIXIR infrastructure

OmicsDI is an Elixir interoperability service. Learn more ›

Tweets

OmicsDI Databases

PRIDE
PeptideAtlas
MassIVE
JPOST Repository
Physiome Model Repository

EGA
EVA
ENA
LINCS
PAXDB
Cell Collective

MetaboLights
Metabolomics Workbench
MetabolomeExpress
GNPS
BioModels
FAIRDOMHub

ArrayExpress
dbGaP
ExpressionAtlas
GEO
NODE

Information

Databases
Help
API
Contact us
Code on GitHub
Terms of use
Submit Data