Dataset Information

Positive selection in the hemagglutinin-neuraminidase gene of Newcastle disease virus and its effect on vaccine efficacy.

ABSTRACT: BACKGROUND: To investigate the relationship between the selective pressure and the sequence variation of the hemagglutinin-neuraminidase (HN) protein, we performed the positive selection analysis by estimating the ratio of non-synonymous to synonymous substitutions with 132 complete HN gene sequences of Newcastle disease viruses (NDVs) isolated in China. RESULTS: The PAML software applying a maximum likelihood method was used for the analysis and three sites (residues 266, 347 and 540) in the HN protein were identified as being under positive selection. Codon 347 was located exactly in a recognized antigenic determinant (residues 345-353) and codon 266 in a predicted linear B-cell epitope. Substitutions at codon 540 contributed to the N-linked glycosylation potential of residue 538. To further evaluate the effect of positively selected sites on the vaccine efficacy, we constructed two recombinant fowlpox viruses rFPV-JS6HN and rFPV-LaSHN, expressing the HN proteins from a genotype VII field isolate Go/JS6/05 (with A266, K347 and A540) and vaccine strain La Sota (with V266, E347 and T540), respectively. Two groups of SPF chickens, 18 each, were vaccinated with the two recombinant fowlpox viruses and challenged by Go/JS6/05 at 3 weeks post-immunization. The results showed that rFPV-JS6HN could elicit more effective immunity against the prevalent virus infection than rFPV-LaSHN in terms of reducing virus shedding. CONCLUSIONS: The analysis of positively selected codons and their effect on the vaccine efficacy indicated that the selective pressure on the HN protein can induce antigenic variation, and new vaccine to control the current ND epidemics should be developed.

SUBMITTER: Gu M

PROVIDER: S-EPMC3101160 | biostudies-literature | 2011

REPOSITORIES: biostudies-literature

ACCESS DATA

Publications

Positive selection in the hemagglutinin-neuraminidase gene of Newcastle disease virus and its effect on vaccine efficacy.

Gu Min M Liu Wujie W Xu Lijun L Cao Yongzhong Y Yao Chunfeng C Hu Shunlin S Liu Xiufan X

Virology journal 20110331

<h4>Background</h4>To investigate the relationship between the selective pressure and the sequence variation of the hemagglutinin-neuraminidase (HN) protein, we performed the positive selection analysis by estimating the ratio of non-synonymous to synonymous substitutions with 132 complete HN gene sequences of Newcastle disease viruses (NDVs) isolated in China.<h4>Results</h4>The PAML software applying a maximum likelihood method was used for the analysis and three sites (residues 266, 347 and 5 ...[more]

PMID: 21453506

Similar Datasets

Project description:Background and aimNewcastle disease (ND) caused by avian paramyxovirus serotype-1 (APMV-1) is long known as an acute contagious and infectious disease of various bird species. Prior studies have acknowledged that the virus could cause up to 100% morbidity and mortality as well as reducing eggs production. In theory, hemagglutinin-neuraminidase (HN) in ND virus (NDV) is one of the surface glycoproteins that functions during the attachment, assembly, and maturation of the virus. On the fields, Indonesia has been recognized as an endemic country for ND where continuous outbreaks of ND in commercial chicken farms have been reported despite the implementation of periodical vaccination programs. Thus, this study aims at characterizing NDV isolated from periodically vaccinated commercial farms, comparing its genetic correlation based on their HN gene fragment with registered NDV originated from Indonesia as well as with existing vaccine strains.Materials and methodsThe HN gene fragment of NDV isolated from well-vaccinated farms was amplified using primer pairs of forward 5' GTGAGTGCAACCCCTTTAGGTTGT 3' and reverse 3' TAGACCCCAGTGATGCATGAGTTG 3' with a 694 bp product length. The nucleotide sequences of nine samples, which were gathered from Kulon Progo, Gunung Kidul (2), Boyolali (2), Magelang, Muntilan (2), Palembang, and Medan, were later compared with the sequences of HN gene of NDV available in NCBI Genbank database. The amino acid sequence analysis and multiple sequence alignment were conducted using the Mega7 program.ResultThe data analysis on amino acid sequences showed that the structure of amino acid residue at positions 345-353 for all isolates appears to be PDEQDYQIR. The structure is the same as for archived samples from Indonesia and either LaSota or B1 vaccine strains. The amino acid distance between observed isolates and LaSota vaccine strain is 8.2-8.8% with a homology value at 91.2-91.7%.ConclusionLooking at amino acid sequence analysis, LaSota vaccines can considerably be stated as being protective against ND disease outbreak. However, the distant homology value from a perfect condition for the protection might have acted as the root cause of vaccination failures.

Dataset Information

Positive selection in the hemagglutinin-neuraminidase gene of Newcastle disease virus and its effect on vaccine efficacy.

Publications

Positive selection in the hemagglutinin-neuraminidase gene of Newcastle disease virus and its effect on vaccine efficacy.

Similar Datasets

OmicsDI is part of the ELIXIR infrastructure