Dataset Information

Alteration of Th17 and Treg cells in patients with unexplained recurrent spontaneous abortion before and after lymphocyte immunization therapy.

ABSTRACT:

Background

Several types of T cells have been associated with the pathogenesis of unexplained recurrent spontaneous abortion (URSA), including Th1/Th2/Th17/Tregs cell. It has been appreciated that immunotherapy with paternal or third party lymphocytes is an effective method of treatment for URSA patients. The balance of Th1/Th2 cells could be maintained and an increase of Treg cells would be beneficial after immunotherapy; however, the mechanism by which the Th17/Treg balance affects URSA has not yet been fully elucidated.

Methods

Here, we used flow cytometry, liquid chip technology and quantitative real-time PCR (qPCR) methods to characterize Th17/Treg cell populations after immunotherapy. We found that after immunotherapy in URSA patients, the percentage of Th17 cells decreased and the percentage of Treg cells in peripheral blood mononuclear cells (PBMC) increased, as detected by flow cytometry.

Results

Immunotherapy may induce a decrease in the Th17/Treg ratio and the Treg bias, which may be beneficial for the maintenance of pregnancy. The expression level of ROR gamma t, a transcription factor found in Th17 cells, decreased and the expression of the Treg-specific transcription factor Foxp3 increased in peripheral blood as detected by qPCR. Immunotherapy may induce a decrease in the ratio of ROR gamma t to Foxp3 and a Treg cell bias, which would be beneficial for pregnancy maintenance. The secretion of the Treg-associated cytokine TGF-beta, as well as Th2 cytokines, was increased in serum, while the secretion of Th17-associated cytokine IL-17A and Th1 cytokine production was decreased. The Th1/Th2 cytokine ratio significantly decreased. Similarly, the Th17/Treg ratio significantly decreased in the total patient after immunotherapy.

Conclusions

These results indicate that in patients with URSA, immunotherapy with mononuclear cells derived from the baby's father could affect both Th1/Th2 and Th17/Treg balance, and we found that the Th2 and Treg bias would be beneficial for pregnancy, which may lead to a balancing of the Th17/Treg ratio in URSA patients after immunotherapy.

SUBMITTER: Wu L

PROVIDER: S-EPMC4237930 | biostudies-literature |

REPOSITORIES: biostudies-literature

ACCESS DATA

Similar Datasets

Project description:Background and aimThe Th17/Treg balance in peripheral blood and reproductive tissues may have a role in the etiology of unexplained recurrent pregnancy loss (URPL). In this study, we evaluated the major cytokine of Treg cells transforming growth factor-beta (TGF-β), and their specific transcription factor Forkhead box P3 (FOXP3), as well as the most highlighted cytokine of Th17 cells (interleukin [IL]-17A) in both URPL patients and healthy women.MethodsSamples were extracted from the peripheral blood, endocervix, endometrium, and vagina of 14 patients with URPL and 12 normal non-pregnant women as a control (normal) group. Quantitative reverse transcription polymerase chain reaction was used to determine gene expression. Enzyme-linked immunosorbent assay was used to determine the levels of cytokines in the serum and cervicovaginal fluid.ResultsWe found that in the URPL group, FOXP3 gene expression was considerably higher in peripheral blood than in the normal group (P=0.043). TGF-β levels in the cervicovaginal fluid were different in the URPL and normal groups (P=0.015). In comparison to the control group, women with URPL had significantly greater IL-17 gene expression in the peripheral blood (P=0.01).ConclusionLower TGF-β levels in the cervicovaginal fluid of patients compared to controls may be related with increased IL-17 and FOXP3 mRNA levels in patients with URPL. Dysregulation of local immune responses in reproductive tissues may represent dysregulation of systemic regulatory immunological responses in the pathogenesis of URPL.Relevance for patientsDysregulation of immune responses may play a role in the pathogenesis of URPL at least in some patients with URPL. We conclude that the breakdown of tolerance in the local immune responses is more critical than the breakdown of tolerance in systemic tolerance in the pathogenesis of URPL. Therefore, modulating immune responses in the endometrium and decidua may be the focus of future therapeutic approaches in URPL. The impact of seminal plasma on the expansion of Tregs may provide a novel therapeutic intervention that has already been used in assisted reproductive technologies. Therefore, we suggest that transvaginal TGF-β in women with URPL may induce maternal tolerance which leads to the successful pregnancy.

Project description:BackgroundThe precise etiology of approximately 50% of patients with recurrent spontaneous abortion (RSA) is unclear, known as unexplained recurrent spontaneous abortion (URSA). This study identified the genetic polymorphisms in patients with URSA.MethodsGenomic DNA was extracted from 30 couples with URSA and 9 couples with normal reproductive history for whole exome sequencing. Variations in annotation, filtering, and prediction of harmfulness and pathogenicity were examined. Furthermore, predictions of the effects of changes in protein structure, Sanger validation, and functional enrichment analyses were performed. The missense mutated genes with significant changes in protein function, and genes with mutations of premature stop, splice site, frameshift, and in-frame indel were selected as candidate mutated genes related to URSA.ResultsIn 30 unrelated couples with URSA, 50%, 20%, and 30% had 2, 3, and more than 4 miscarriages, respectively. Totally, 971 maternal and 954 paternal mutations were found to be pathogenic or possibly pathogenic after preliminary filtering. Total variations were not associated with age nor the number of miscarriages. In 28 patients (involving 23 couples), 22 pathogenic or possibly pathogenic variants of 19 genes were found to be strongly associated with URSA, with an abnormality rate of 76.67%. Among these, 12 missense variants showed obvious changes in protein functions, including ANXA5 (c.949G>C; p.G317R), APP (c.1530G>C; p.K510N), DNMT1 (c.2626G>A; p.G876R), FN1 (c.5621T>C; p.M1874T), MSH2 (c.1168G>A; p.L390F), THBS1 (c.2099A>G; p.N700S), KDR (c.2440G>A; p.D814N), POLR2B (c.406G>T; p.G136C), ITGB1 (c.655T>C; p.Y219H), PLK1 (c.1210G>T; p.A404S), COL4A2 (c.4808 A>C; p.H1603P), and LAMA4 (c.3158A>G; p.D1053G). Six other genes with mutations of premature stop, splice site, frameshift, and in-frame indel were also identified, including BUB1B (c.1648C>T; p.R550*) and MMP2 (c.1462_1464delTTC; p.F488del) from the father, and mutations from mother and/or father including BPTF (c.396_398delGGA; p.E138 del and c.429_431GGA; p.E148del), MECP2 (c.21_23delCGC; p.A7del), LAMA2 (HGVS: NA; Exon: NA; SPLICE_SITE, DONOR), and SOX21 (c.640 _641insT; p. A214fs, c.644dupC; p. A215fs and c.644_645ins ACGCGTCTTCTTCCCGCAGTC; p. A215dup).ConclusionsThese pathogenic or potentially pathogenic mutated genes may be potential biomarkers for URSA and may play an auxiliary role in the treatment of URSA.

Project description:BackgroundUnexplained recurrent spontaneous abortion (URSA) is one of the most challenging conditions frustrates women of childbearing age profoundly. The gene expression patterns and biological characteristics of placental villus in patients with URSA remain largely unknown. The aim of our study was to identify potential lncRNAs as well as their action mechanisms in URSA.MethodThe ceRNA microarray was used to identify the mRNA and lncRNA expression profiles of URSA patients and normal pregnancy. Functional enrichment analyses for differentially expressed mRNAs in URSA were performed. Protein-protein interaction analysis of differentially expressed mRNAs was performed to identify hub genes and key modules. Subsequently, the co-dysregulated ceRNA network of URSA was established, and the enrichment analyses for the mRNAs in the ceRNA network was implemented. qRT-PCR was performed to validated the expression of key ENST00000429019 and mRNAs in URSA.ResultsWe found that URSA placental villus have distinct mRNA and lncRNA expression profiles through ceRNA microarray, with a total of 347 mRNAs and 361 lncRNAs differentially expressed compared with controls. The functional enrichment analysis revealed that ncRNA processing, DNA replication, cell cycle, apoptosis, cytokine-mediated signaling pathway, ECM-receptor interaction were the potentially disrupted pathways in URSA patients. Then we constructed a co-dysregulated ceRNA network and found differentially expressed mRNAs were regulated by a small fraction of hub lncRNAs. Finally, we found a key network of ENST00000429019 and three cell proliferation or apoptosis related key mRNAs (CDCA3, KIFC1, NCAPH), and validated their expression and regulation in tissue and cellular levels.ConclusionsThis study identified a key ceRNA network, which might take part in URSA and correlate with cell proliferation and apoptosis. Optimistically, this study may deepen our apprehensions about the underlying molecular and biological causes of URSA and provide an important theoretical basis for future therapeutic strategies for patients with URSA.