Dataset Information

Screening and mechanistic study of key sites of the hemagglutinin-neuraminidase protein related to the virulence of Newcastle disease virus.

ABSTRACT: Newcastle disease is a kind of avian infectious disease caused by Newcastle disease virus (NDV). The virulence of NDV is dependent mainly on the fusion (F) protein and hemagglutinin-neuraminidase (HN) protein. The genomes of 2 viruses, NDV-Blackbird and NDV-Dove, are 99.9% similar, while NDV-Blackbird is a velogenic virus, and NDV-Dove is a lentogenic virus. Further analysis revealed that the F proteins of the 2 strains were identical, and only 5 amino acid sites on the HN proteins were inconsistent. Five different HN mutant plasmids were constructed and analyzed in this study. The results showed that the mutation F110L caused a significant increase in fusion-promotion activity caused by an increase in neuraminidase activity. Because of the increase in receptor-binding activity caused by G116R, there was a significant increase in fusion-promotion activity. The mutation G54S resulted in a slight decrease in the fusion-promotion activity caused by a slight decrease in receptor-binding activity. The slight increase in the fusion-promotion activity caused by A469V was associated with a significant increase in neuraminidase activity. Therefore, the amino acids L110 and R116 played a key role in determining the virulence difference between NDV-Blackbird and NDV-Dove, which could lay a foundation for illuminating the virulence differences of NDV strains, as well as the development of attenuated vaccines.

SUBMITTER: Yan C

PROVIDER: S-EPMC7597932 | biostudies-literature | 2020 Jul

REPOSITORIES: biostudies-literature

ACCESS DATA

Publications

Screening and mechanistic study of key sites of the hemagglutinin-neuraminidase protein related to the virulence of Newcastle disease virus.

Yan Chuanqi C Liu Haijin H Jia Yanqing Y Prince-Theodore Daguia-Wenam DW Yang Mengqing M Addoma Adam Fathalrhman Eisa FE Ren Juan J Cao Xuhong X Wang Xinglong X Xiao Sa S Zhang Shuxia S Yang Zengqi Z

Poultry science 20200504 7

Newcastle disease is a kind of avian infectious disease caused by Newcastle disease virus (NDV). The virulence of NDV is dependent mainly on the fusion (F) protein and hemagglutinin-neuraminidase (HN) protein. The genomes of 2 viruses, NDV-Blackbird and NDV-Dove, are 99.9% similar, while NDV-Blackbird is a velogenic virus, and NDV-Dove is a lentogenic virus. Further analysis revealed that the F proteins of the 2 strains were identical, and only 5 amino acid sites on the HN proteins were inconsis ...[more]

PMID: 32616231

Similar Datasets

Project description:Zanamivir (4-guanidino-Neu5Ac2en [4-GU-DANA]) inhibits not only the neuraminidase activity but also the receptor interaction of the human parainfluenza virus type 3 (HPIV3) hemagglutinin-neuraminidase (HN), blocking receptor binding and subsequent fusion promotion. All activities of the HPIV3 variant ZM1 HN (T193I/I567V) are less sensitive to 4-GU-DANA's effects. The T193I mutation in HN confers both increased receptor binding and increased neuraminidase activity, as well as reduced sensitivities of both activities to 4-GU-DANA inhibition, consistent with a single site on the HN molecule carrying out both catalysis and binding. We now provide evidence that the HPIV3 variant's resistance to receptor-binding inhibition by 4-GU-DANA is related to a reduced affinity of the HN receptor-binding site for this compound as well as to an increase in the avidity of HN for the receptor. Newcastle disease virus (NDV) HN and HPIV3 HN respond differently to inhibition in ways that suggest a fundamental distinction between them. NDV HN-receptor binding is less sensitive than HPIV3 HN-receptor binding to 4-GU-DANA, while its neuraminidase activity is highly sensitive. Both HPIV3 and NDV HNs are sensitive to receptor-binding inhibition by the smaller molecule DANA. However, for NDV HN, some receptor binding cannot be inhibited. These data are consistent with the presence in NDV HN of a second receptor-binding site that is devoid of enzyme activity and has a negligible, if any, affinity for 4-GU-DANA. Avidity for the receptor contributes to resistance by allowing the receptor to compete effectively with inhibitors for interaction with HN, while the further determinant of resistance is the reduced binding of the inhibitor molecule to the binding pocket on HN. Based upon our data and recent three-dimensional structural information on the HPIV3 and NDV HNs, we propose mechanisms for the observed sensitivity and resistance of HN to receptor-binding inhibition and discuss the implications of these mechanisms for the distribution of HN functions.

Project description:Background and aimNewcastle disease (ND) caused by avian paramyxovirus serotype-1 (APMV-1) is long known as an acute contagious and infectious disease of various bird species. Prior studies have acknowledged that the virus could cause up to 100% morbidity and mortality as well as reducing eggs production. In theory, hemagglutinin-neuraminidase (HN) in ND virus (NDV) is one of the surface glycoproteins that functions during the attachment, assembly, and maturation of the virus. On the fields, Indonesia has been recognized as an endemic country for ND where continuous outbreaks of ND in commercial chicken farms have been reported despite the implementation of periodical vaccination programs. Thus, this study aims at characterizing NDV isolated from periodically vaccinated commercial farms, comparing its genetic correlation based on their HN gene fragment with registered NDV originated from Indonesia as well as with existing vaccine strains.Materials and methodsThe HN gene fragment of NDV isolated from well-vaccinated farms was amplified using primer pairs of forward 5' GTGAGTGCAACCCCTTTAGGTTGT 3' and reverse 3' TAGACCCCAGTGATGCATGAGTTG 3' with a 694 bp product length. The nucleotide sequences of nine samples, which were gathered from Kulon Progo, Gunung Kidul (2), Boyolali (2), Magelang, Muntilan (2), Palembang, and Medan, were later compared with the sequences of HN gene of NDV available in NCBI Genbank database. The amino acid sequence analysis and multiple sequence alignment were conducted using the Mega7 program.ResultThe data analysis on amino acid sequences showed that the structure of amino acid residue at positions 345-353 for all isolates appears to be PDEQDYQIR. The structure is the same as for archived samples from Indonesia and either LaSota or B1 vaccine strains. The amino acid distance between observed isolates and LaSota vaccine strain is 8.2-8.8% with a homology value at 91.2-91.7%.ConclusionLooking at amino acid sequence analysis, LaSota vaccines can considerably be stated as being protective against ND disease outbreak. However, the distant homology value from a perfect condition for the protection might have acted as the root cause of vaccination failures.

Dataset Information

Screening and mechanistic study of key sites of the hemagglutinin-neuraminidase protein related to the virulence of Newcastle disease virus.

Publications

Screening and mechanistic study of key sites of the hemagglutinin-neuraminidase protein related to the virulence of Newcastle disease virus.

Similar Datasets

OmicsDI is part of the ELIXIR infrastructure