Browse
Submit Data
Databases
API
Help

Dataset Information

0 Views

0 Connections

0 Citations

0 Reanalyses

0 Downloads

Omics score: 0

Transcriptome sequencing from Nicotiana benthamiana leaves non-infected and infected with Turnip mosaic virus (TuMV)

ABSTRACT: Transcriptome sequencing from Nicotiana benthamiana leaves non-infected and infected with Turnip mosaic virus (TuMV)

PROVIDER: PRJNA704624 | ENA |

REPOSITORIES: ENA

ACCESS DATA

Json Xml

Dataset's files

Source:

			Action	DRS
	SRR13777253_1.fastq.gz	Fastqsanger.gz
	SRR13777253_2.fastq.gz	Fastqsanger.gz
	SRR13777254_1.fastq.gz	Fastqsanger.gz
	SRR13777254_2.fastq.gz	Fastqsanger.gz
	SRR13777255_1.fastq.gz	Fastqsanger.gz

Items per page:

1 - 5 of 12

Similar Datasets

Transcriptome sequencing from Nicotiana benthamiana leaves non-infected and infected with Turnip mosaic virus (TuMV)

Project description:Transcriptome sequencing from Nicotiana benthamiana leaves non-infected and infected with Turnip mosaic virus at 6 days post inoculation.

2021-02-25 | GSE167415 | GEO

sRNAseq from Arabidopsis leaves non-infected and infected with Turnip mosaic virus (TuMV)

Project description:Sequencing of small RNAs from Arabidopsis leaves non-infected and infected with Turnip mosaic virus at 14 days post inoculation

2018-03-01 | GSE110940 | GEO

sRNAseq from Arabidopsis leaves non-infected and infected with Turnip mosaic virus (TuMV)

Project description:sRNAseq from Arabidopsis leaves non-infected and infected with Turnip mosaic virus (TuMV)

| PRJNA434890 | ENA

Label-free quantitative proteomics on Nicotiana benthamiana plasmodesmal proteome following viral infection

Project description:We analyzed the PD-enriched fraction from Turnip mosaic virus (TuMV)-infected Nicotiana benthmiana (N. benthamiana) by using label-free quantitative proteomics of which 100 and 48 were significantly increased and decreased respectively when compared with mock plants.

2017-10-19 | PXD006323 | Pride

The effect of TuMV on translation initiation in Arabidopsis

Project description:Arabidopsis ecotype Col-0 expressing RPL18 fused to His & Flag epitopes (RPL18-HF) under 35S control was used to discern the effects of Turnip mosaic virus (TuMV) infection on host translation initiation. Plants were grown in LC-1 soil in 12 hour days and infected by TuMV-GFP or mock-inoculated just prior to sending up bolts. Samples were taken from rosette leaves 10 days after inoculation. Only tissue fluorescing GFP was selected from the virus-infected samples. Similar tissue was sampled from mock-infected leaves. FLAG antibody was used to isolate RPL18-HF. The RNA co-immunoprecipitated with RPL18-HF is fully translation-initiated. This translation-initiated RNA, also referred to as polysomal RNA, was isolated and compared to total RNA under both mock and TuMV-infected states to find TuMV-induced changes in host translation initiation. ****[PLEXdb(http://www.plexdb.org) has submitted this series at GEO on behalf of the original contributor, Jackson Moeller. The equivalent experiment is AT42 at PLEXdb.]

2011-03-11 | GSE20278 | GEO

The effect of TuMV on translation initiation in Arabidopsis

2011-03-11 | E-GEOD-20278 | biostudies-arrayexpress

Roles and Programming of Arabidopsis ARGONAUTE Proteins During Turnip Mosaic Virus Infection

Project description:AGO protein immunoprecipitation was combined with high-throughput sequencing of associated small RNAs. AGO2, AGO10, and to a lesser extent AGO1 were shown to associate with siRNAs derived from silencing suppressor (HC-Pro)-deficient TuMV-AS9, but not with siRNAs derived from wild-type TuMV. Co-immunoprecipitation and small RNA sequencing revealed that viral siRNAs broadly associated with wild-type HC-Pro during TuMV infection. These results support the hypothesis that suppression of antiviral silencing during TuMV infection, at least in part, occurs through sequestration of virus-derived siRNAs away from antiviral AGO proteins by HC-Pro. Catalytic mutant HA-AGO1-DAH, HA-AGO2-DAD and HA-AGO10-DAH or catalytically active HA-AGO10-DDH were immunoprecipitated from buffer (mock) or inoculated rosette leaves (at 7 dpi) or noninoculated cauline leaves at 10 dpi with wt TuMV or suppressor-deficient TuMV-AS9. Inflorescence from TuMV infected plants was collected at 10 dpi with wt TuMV. HC-Pro was tagged with 6xHIS in TuMV-HIS and suppressor-deficient TuMV-HIS-AS9. HC-Pro was immunoprecipitated from noninoculated cauline leaves of inflorescence at 10 dpi. HC-Pro AS9 was immunoprecipitated from noninoculated cauline leaves at 15 dpi. Total RNA was extracted from input fraction and small RNAs separated by size fractionation. Small RNAs in input and HA-AGO or HC-Pro immunoprecipitation fractions were converted to DNA Amplicons by 5' (GUUCAGAGUUCUACAGUCCGACGAUC) or 3’ (CTGTAGGCACCATCAAT) adaptor ligation followed by RT-PCR. DNA Amplicons were sequenced using the Illumina HiSeq2000 platform. Duplicate libraries were made per treatment. For each library, hits to TuMV, to TuMV-HIS and to Arabidopsis thaliana were included in separate files.

2015-04-06 | E-GEOD-64911 | biostudies-arrayexpress

Expression analysis of systemically infected Nicotiana benthamiana infected by South African cassava mosaic virus (SACMV)

Project description:Micrarray analysis was used to identify gene expression changes associated with disease development and virus movement in N.benthamina plants induced by infection with the SACMV 1-Plex , 385K array Nicotiana benthamiana (NimbleGen design name: 110121_N_benthamiana_60mer_exp) was used in this study to monitor changes in gene expression levels in SACMV- infected leaf tissue. Three biological replicates were used for infected leaf tissue and one pooled mock-inoculated sample was used as a control/reference.

2013-01-17 | E-GEOD-43584 | biostudies-arrayexpress

Roles and Programming of Arabidopsis ARGONAUTE Proteins During Turnip Mosaic Virus Infection

2015-04-06 | GSE64911 | GEO

Comparison of endogenous and viral microRNA profile of Arabidopsis thaliana with and without Turnip Mosaic Virus infection.

Project description:Individual miRNA profile was identified for two Col-0 WT replicates and two Col-0 TuMV infected plant replicate samples, with 12-15 plants in each replicate.Comparison was done based on the microRNA expression profile in both biological replicates for infected and uninfected plant samples .

2010-06-27 | GSE22583 | GEO

OmicsDI is part of the ELIXIR infrastructure

OmicsDI is an Elixir interoperability service. Learn more ›

Tweets

OmicsDI Databases

PRIDE
PeptideAtlas
MassIVE
JPOST Repository
Physiome Model Repository

EGA
EVA
ENA
LINCS
PAXDB
Cell Collective

MetaboLights
Metabolomics Workbench
MetabolomeExpress
GNPS
BioModels
FAIRDOMHub

ArrayExpress
dbGaP
ExpressionAtlas
GEO
NODE

Information

Databases
Help
API
Contact us
Code on GitHub
Terms of use
Submit Data