Browse
Submit Data
Databases
API
Help

Dataset Information

0 Views

0 Connections

0 Citations

0 Reanalyses

0 Downloads

Omics score: 0

SRNAseq from Arabidopsis leaves non-infected and infected with Turnip mosaic virus (TuMV)

ABSTRACT: sRNAseq from Arabidopsis leaves non-infected and infected with Turnip mosaic virus (TuMV)

PROVIDER: PRJNA434890 | ENA |

REPOSITORIES: ENA

ACCESS DATA

Json Xml

Dataset's files

Source:

			Action	DRS
	SRR6757371.fastq.gz	Fastqsanger.gz
	SRR6757372.fastq.gz	Fastqsanger.gz

Items per page:

1 - 2 of 2

Similar Datasets

sRNAseq from Arabidopsis leaves non-infected and infected with Turnip mosaic virus (TuMV)

Project description:Sequencing of small RNAs from Arabidopsis leaves non-infected and infected with Turnip mosaic virus at 14 days post inoculation

2018-03-01 | GSE110940 | GEO

Transcriptome sequencing from Nicotiana benthamiana leaves non-infected and infected with Turnip mosaic virus (TuMV)

Project description:Transcriptome sequencing from Nicotiana benthamiana leaves non-infected and infected with Turnip mosaic virus at 6 days post inoculation.

2021-02-25 | GSE167415 | GEO

Transcriptome sequencing from Nicotiana benthamiana leaves non-infected and infected with Turnip mosaic virus (TuMV)

Project description:Transcriptome sequencing from Nicotiana benthamiana leaves non-infected and infected with Turnip mosaic virus (TuMV)

| PRJNA704624 | ENA

The effect of TuMV on translation initiation in Arabidopsis

Project description:Arabidopsis ecotype Col-0 expressing RPL18 fused to His & Flag epitopes (RPL18-HF) under 35S control was used to discern the effects of Turnip mosaic virus (TuMV) infection on host translation initiation. Plants were grown in LC-1 soil in 12 hour days and infected by TuMV-GFP or mock-inoculated just prior to sending up bolts. Samples were taken from rosette leaves 10 days after inoculation. Only tissue fluorescing GFP was selected from the virus-infected samples. Similar tissue was sampled from mock-infected leaves. FLAG antibody was used to isolate RPL18-HF. The RNA co-immunoprecipitated with RPL18-HF is fully translation-initiated. This translation-initiated RNA, also referred to as polysomal RNA, was isolated and compared to total RNA under both mock and TuMV-infected states to find TuMV-induced changes in host translation initiation. ****[PLEXdb(http://www.plexdb.org) has submitted this series at GEO on behalf of the original contributor, Jackson Moeller. The equivalent experiment is AT42 at PLEXdb.]

2011-03-11 | GSE20278 | GEO

The effect of TuMV on translation initiation in Arabidopsis

2011-03-11 | E-GEOD-20278 | biostudies-arrayexpress

Roles and Programming of Arabidopsis ARGONAUTE Proteins During Turnip Mosaic Virus Infection

Project description:AGO protein immunoprecipitation was combined with high-throughput sequencing of associated small RNAs. AGO2, AGO10, and to a lesser extent AGO1 were shown to associate with siRNAs derived from silencing suppressor (HC-Pro)-deficient TuMV-AS9, but not with siRNAs derived from wild-type TuMV. Co-immunoprecipitation and small RNA sequencing revealed that viral siRNAs broadly associated with wild-type HC-Pro during TuMV infection. These results support the hypothesis that suppression of antiviral silencing during TuMV infection, at least in part, occurs through sequestration of virus-derived siRNAs away from antiviral AGO proteins by HC-Pro. Catalytic mutant HA-AGO1-DAH, HA-AGO2-DAD and HA-AGO10-DAH or catalytically active HA-AGO10-DDH were immunoprecipitated from buffer (mock) or inoculated rosette leaves (at 7 dpi) or noninoculated cauline leaves at 10 dpi with wt TuMV or suppressor-deficient TuMV-AS9. Inflorescence from TuMV infected plants was collected at 10 dpi with wt TuMV. HC-Pro was tagged with 6xHIS in TuMV-HIS and suppressor-deficient TuMV-HIS-AS9. HC-Pro was immunoprecipitated from noninoculated cauline leaves of inflorescence at 10 dpi. HC-Pro AS9 was immunoprecipitated from noninoculated cauline leaves at 15 dpi. Total RNA was extracted from input fraction and small RNAs separated by size fractionation. Small RNAs in input and HA-AGO or HC-Pro immunoprecipitation fractions were converted to DNA Amplicons by 5' (GUUCAGAGUUCUACAGUCCGACGAUC) or 3’ (CTGTAGGCACCATCAAT) adaptor ligation followed by RT-PCR. DNA Amplicons were sequenced using the Illumina HiSeq2000 platform. Duplicate libraries were made per treatment. For each library, hits to TuMV, to TuMV-HIS and to Arabidopsis thaliana were included in separate files.

2015-04-06 | E-GEOD-64911 | biostudies-arrayexpress

Roles and Programming of Arabidopsis ARGONAUTE Proteins During Turnip Mosaic Virus Infection

2015-04-06 | GSE64911 | GEO

Comparison of endogenous and viral microRNA profile of Arabidopsis thaliana with and without Turnip Mosaic Virus infection.

Project description:Individual miRNA profile was identified for two Col-0 WT replicates and two Col-0 TuMV infected plant replicate samples, with 12-15 plants in each replicate.Comparison was done based on the microRNA expression profile in both biological replicates for infected and uninfected plant samples .

2010-06-27 | GSE22583 | GEO

Turnip Yellow Mosaic Virus

Project description:Turnip Yellow Mosaic Virus Raw sequence reads

| PRJNA277612 | ENA

Turnip yellow mosaic virus

Project description:Turnip yellow mosaic virus Raw sequence reads

| PRJNA283239 | ENA