Anopheles punctipennis its2 sequencing
Ontology highlight
ABSTRACT:
PROVIDER: PRJEB39787 | ENA |
REPOSITORIES: ENA
Similar Datasets
Project description:Sequencing of ITS2 from Eurasian Anopheles mosquitoes An. messeae, An. daciae and their hybrids
| PRJEB56139 | ENA
Project description:In the present study, we have investigated the effect of CpG Oligodeoxynucleotides (CpG-ODN) on the outcome of Plasmodium infection of the mosquito vectors Anopheles stephensi and Anopheles gambiae and on the modulation of mosquito immunity to Plasmodium. Anopheles mosquitoes inoculated with CpG-ODN showed significant reduction of Plasmodium infection rate and intensity. Microarrays were used to profile transcription of fat-body from CpG-ODN-treated mosquitoes. Mosquitoes were dissected 18h after ODN inoculation (immediately before feeding). Batches of 20 to 30 fat bodies (abdomen without midgut, ovaries and malpighian tubule]) were dissected in cold DEPC-treated phosphate-buffered saline (PBS) and processed for RNA preparation. Mosquitoes treated with CpG-ODNs are less susceptible to Plasmodium infection. Transcription profile of fat body indicates that protection was associated with coagulation/wound healing, while melanization appears to be depressed.
2013-04-02 | GSE26941 | GEO
Project description:We report the use of RNA-seq data to assemble transcriptional units of adult Anopheles funestus female mosquitoes. We also analyzed expression levels and protein divergence and discovered SNPs.
2010-12-01 | GSE21977 | GEO
Project description:In the present study, we have investigated the effect of CpG Oligodeoxynucleotides (CpG-ODN) on the outcome of Plasmodium infection of the mosquito vectors Anopheles stephensi and Anopheles gambiae and on the modulation of mosquito immunity to Plasmodium. Anopheles mosquitoes inoculated with CpG-ODN showed significant reduction of Plasmodium infection rate and intensity. Microarrays were used to profile transcription of fat-body from CpG-ODN-treated mosquitoes. Mosquitoes were dissected 18h after ODN inoculation (immediately before feeding). Batches of 20 to 30 fat bodies (abdomen without midgut, ovaries and malpighian tubule]) were dissected in cold DEPC-treated phosphate-buffered saline (PBS) and processed for RNA preparation. Mosquitoes treated with CpG-ODNs are less susceptible to Plasmodium infection. Transcription profile of fat body indicates that protection was associated with coagulation/wound healing, while melanization appears to be depressed. Anopheles gambiae s.s. mosquitoes were reared at 25 M-BM-:C and 75% humidity with a 12-hour light/dark cycle. Adult mosquitoes were maintained on a 10% glucose solution. Three- to four-day-old female mosquitoes were cold-anaesthetized and inoculated intratoraxically with 69nl of a 0.1mM CpG-oligodeoxynucleotide (0604 -5M-bM-^@M-^Y TCCATGACGTTCCTGATGCT 3M-bM-^@M-^Y) solution or with the same volume of elution buffer using a Nanoject micro-injector (Drummond Scientific). Mosquitoes were left to rest for 18h. Batches of 20 to 30 fat bodies (abdomen without midgut, ovaries and malpighian tubule) were dissected in cold DEPC-treated phosphate-buffered saline (PBS) and processed for RNA preparation. Two independent experiments were performed for each treatment.
2013-04-02 | E-GEOD-26941 | biostudies-arrayexpress
Project description:we report the RNA-seq based analyses of the transcriptional changes in the Anopheles gambiae mosquitoes from East Africa classified as deltamethrin-resistant or -suscpetible accordign the WHO test
2012-10-01 | GSE39269 | GEO
Project description:Plasmodium parasites within mosquitoes are exposed to various physiological processes, such as blood meal digestion activity, the gonotrophic cycle, and host responses preventing the entry of parasites into the midgut wall. However, when in vitro-cultured ookinetes are injected into the hemocoel of mosquitoes, Plasmodium parasites are not affected by the vertebrate host’s blood contents and do not pass through the midgut epithelial cells. This infection method might aid in identifying mosquito-derived factors affecting Plasmodium development within mosquitoes. This study investigated novel mosquito-derived molecules related to parasite development in Anopheles mosquitoes. We injected in vitro-cultured Plasmodium berghei (ANKA strain) ookinetes into female and male Anopheles stephensi (STE2 strain) mosquitoes and found that the oocyst number was significantly higher in males than in females, suggesting that male mosquitoes better support the development of parasites. Next, RNA-seq analysis was performed on the injected female and male mosquitoes to identify genes exhibiting changes in expression. Five genes with different expression patterns between sexes and greatest expression changes were identified as being potentially associated with Plasmodium infection. Two of the five genes also showed expression changes with infection by blood-feeding, indicating that these genes could affect the development of Plasmodium parasites in mosquitoes.
2024-05-06 | GSE197159 | GEO
Project description:we report the RNA-seq based analyses of the transcriptional changes in the Anopheles gambiae mosquitoes from East Africa classified as deltamethrin-resistant or -suscpetible accordign the WHO test comparison of the transcriptome of Anopheles gambiae mosquitoes with phenotypically resistant or suscpetible to deltamethrin
2012-10-01 | E-GEOD-39269 | biostudies-arrayexpress
Project description:Anopheline mosquitoes frequently take multiple blood meals in a single gonotrophic cycle. In this study we determined patterns of gene expression in Anopheles gambiae females blood fed twice within the first gonotrophic cycle.
2010-07-08 | GSE22806 | GEO
Project description:The age of mosquitoes is a crucial determinant of their susceptibility to infection, probability of survival to transmit pathogens and tolerance to insecticides. We investigated changes to the abundance of proteins found in heads and thoraces of Anopheles gambiae and Anopheles stephensi as they aged. Protein expression changes were assessed using two-dimensional difference gel electrophoresis and the identity of differentially expressed proteins was determined by using either matrix-assisted laser desorption ionization tandem time-of-flight mass spectrometry or capillary high-pressure liquid chromatography coupled with a linear ion-trap (LTQ)-Orbitrap XL hybrid mass spectrometer. Protein biomarkers were validated by quantitative Western blot analysis.
2015-08-26 | PXD002153 | Pride
Project description:Wolbachia, an endosymbiotic bacterium, is being investigated as a vector control agent in several insect species. Along with the well known classical reproductive parasitism Wolbachia employs against its host to spread within the population, it is emerging that the bacteria can protect the host against pathogens and reduced pathogen transmission. Anopheles mosquitoes, which transmit malaria, have never been found to harbour Wolbachia in nature, and despite numerous transinfection attempts, no stable line has been developed. However recently, two strains of Wolbachia, wAlbB from Aedes albopictus, and wRi from Drosophila simulans were cultured in Anopheles gambiae Sua5B cells. These cell lines provides an amenable system to study Wolbachia-Anopheles interaction in the absence of a stable transinfected line. It has been proposed that the compromised vector competence of Wolbachia infected insects is due to an up regulation of the basal immune state. We therefore completed a genome wide expression profile of Wolbachia infected Anopheles, assessing both wAlbB and wRi infected cells in parallel against uninfected Sua5B cells.
2011-03-02 | GSE23215 | GEO