Browse
Submit Data
Databases
API
Help

Dataset Information

0 Views

0 Connections

0 Citations

0 Reanalyses

0 Downloads

Omics score: 0

The transcriptional changes in the transcriptome of Control and Bacillus sphaericus(Bs)-treated Anopheles dirus mosquitoes

ABSTRACT: We report the RNA-seq based analyses of the transcriptional changes in the transcriptome of Control and Bacillus sphaericus(Bs)-treated Anopheles dirus mosquitoes

ORGANISM(S): Anopheles dirus

PROVIDER: GSE272494 | GEO | 2025/03/26

REPOSITORIES: GEO

ACCESS DATA

Json Xml

Dataset's files

Source:

			Action	DRS
		Other

Items per page:

1 - 1 of 1

Similar Datasets

The transcriptional changes in the transcriptome of Control and Bacillus sphaericus(Bs)-treated Anopheles dirus mosquitoes

Project description:The transcriptional changes in the transcriptome of Control and Bacillus sphaericus(Bs)-treated Anopheles dirus mosquitoes

| PRJNA1136975 | ENA

CpG Oligodeoxynucleotides treatment of Anopheles mosquitoes

2013-04-02 | GSE26941 | GEO

CpG Oligodeoxynucleotides treatment of Anopheles mosquitoes

Project description:In the present study, we have investigated the effect of CpG Oligodeoxynucleotides (CpG-ODN) on the outcome of Plasmodium infection of the mosquito vectors Anopheles stephensi and Anopheles gambiae and on the modulation of mosquito immunity to Plasmodium. Anopheles mosquitoes inoculated with CpG-ODN showed significant reduction of Plasmodium infection rate and intensity. Microarrays were used to profile transcription of fat-body from CpG-ODN-treated mosquitoes. Mosquitoes were dissected 18h after ODN inoculation (immediately before feeding). Batches of 20 to 30 fat bodies (abdomen without midgut, ovaries and malpighian tubule]) were dissected in cold DEPC-treated phosphate-buffered saline (PBS) and processed for RNA preparation. Mosquitoes treated with CpG-ODNs are less susceptible to Plasmodium infection. Transcription profile of fat body indicates that protection was associated with coagulation/wound healing, while melanization appears to be depressed. Anopheles gambiae s.s. mosquitoes were reared at 25 M-BM-:C and 75% humidity with a 12-hour light/dark cycle. Adult mosquitoes were maintained on a 10% glucose solution. Three- to four-day-old female mosquitoes were cold-anaesthetized and inoculated intratoraxically with 69nl of a 0.1mM CpG-oligodeoxynucleotide (0604 -5M-bM-^@M-^Y TCCATGACGTTCCTGATGCT 3M-bM-^@M-^Y) solution or with the same volume of elution buffer using a Nanoject micro-injector (Drummond Scientific). Mosquitoes were left to rest for 18h. Batches of 20 to 30 fat bodies (abdomen without midgut, ovaries and malpighian tubule) were dissected in cold DEPC-treated phosphate-buffered saline (PBS) and processed for RNA preparation. Two independent experiments were performed for each treatment.

2013-04-02 | E-GEOD-26941 | biostudies-arrayexpress

Comparative transcriptome analyses of deltmethrin resistant and suscpetible Anopheles gambiae mosquitoes

2012-10-01 | GSE39269 | GEO

Searching for new molecules involved in Anopheles mosquitoes’ response to Plasmodium infection

Project description:Plasmodium parasites within mosquitoes are exposed to various physiological processes, such as blood meal digestion activity, the gonotrophic cycle, and host responses preventing the entry of parasites into the midgut wall. However, when in vitro-cultured ookinetes are injected into the hemocoel of mosquitoes, Plasmodium parasites are not affected by the vertebrate host’s blood contents and do not pass through the midgut epithelial cells. This infection method might aid in identifying mosquito-derived factors affecting Plasmodium development within mosquitoes. This study investigated novel mosquito-derived molecules related to parasite development in Anopheles mosquitoes. We injected in vitro-cultured Plasmodium berghei (ANKA strain) ookinetes into female and male Anopheles stephensi (STE2 strain) mosquitoes and found that the oocyst number was significantly higher in males than in females, suggesting that male mosquitoes better support the development of parasites. Next, RNA-seq analysis was performed on the injected female and male mosquitoes to identify genes exhibiting changes in expression. Five genes with different expression patterns between sexes and greatest expression changes were identified as being potentially associated with Plasmodium infection. Two of the five genes also showed expression changes with infection by blood-feeding, indicating that these genes could affect the development of Plasmodium parasites in mosquitoes.

2024-05-06 | GSE197159 | GEO

Comparative transcriptome analyses of deltmethrin resistant and suscpetible Anopheles gambiae mosquitoes

Project description:we report the RNA-seq based analyses of the transcriptional changes in the Anopheles gambiae mosquitoes from East Africa classified as deltamethrin-resistant or -suscpetible accordign the WHO test comparison of the transcriptome of Anopheles gambiae mosquitoes with phenotypically resistant or suscpetible to deltamethrin

2012-10-01 | E-GEOD-39269 | biostudies-arrayexpress

Bacillus sp. BS strain:BS

Project description:Bacillus sp. BS strain:BS Genome sequencing

| PRJNA1151218 | ENA

Transcription profiling of female Anopheles gambiae mosquitoes blood fed on mice infected with P. berghei and treated with chloroquine or untreated

Project description:The effect of chloroquine on mosquitoes transcript abundance was assayed by comparing gene expression between mosquitoes fed on a blood meal containing 50 mg/Kg of chloroquine and those that had fed on a normal blood meal. Pools of 50 midguts were dissected and were hybridize with MMC1 (or 20K) microarrays. <br><br>Anopheles gambiae female mosquitoes were blood fed on BALB/c mice infected with P. berghei and intraperitonally pre-treated with 50 mg/kg of chloroquine. As controls, mosquitoes were blood fed on untreated P. berghei infected mice.<br><br>Mosquitoes were collected 24 hours post-blood feeding and pools of 50 midguts were dissected and processed for hybridization with MMC1 (or 20K) microarrays.Two different biological experiments were performed for each treatment.

2007-10-12 | E-MEXP-1201 | biostudies-arrayexpress

Proteomic changes occurring in Anopheles gambiae and Anopheles stephensi during aging

Project description:The age of mosquitoes is a crucial determinant of their susceptibility to infection, probability of survival to transmit pathogens and tolerance to insecticides. We investigated changes to the abundance of proteins found in heads and thoraces of Anopheles gambiae and Anopheles stephensi as they aged. Protein expression changes were assessed using two-dimensional difference gel electrophoresis and the identity of differentially expressed proteins was determined by using either matrix-assisted laser desorption ionization tandem time-of-flight mass spectrometry or capillary high-pressure liquid chromatography coupled with a linear ion-trap (LTQ)-Orbitrap XL hybrid mass spectrometer. Protein biomarkers were validated by quantitative Western blot analysis.

2015-08-26 | PXD002153 | Pride

Transcription profiling of Anopheles gambiae female bodies from virgin mosquitoes and 2, 6 and 24 hours after mating

Project description:Changes in gene expression in whole Anopheles gambiae female bodies between virgin mosquitoes and females samples at 2h, 6h, and 24h after mating.

2009-01-01 | E-MEXP-1868 | biostudies-arrayexpress

OmicsDI is part of the ELIXIR infrastructure

OmicsDI is an Elixir interoperability service. Learn more ›

Tweets

OmicsDI Databases

PRIDE
PeptideAtlas
MassIVE
JPOST Repository
Physiome Model Repository

EGA
EVA
ENA
LINCS
PAXDB
Cell Collective

MetaboLights
Metabolomics Workbench
MetabolomeExpress
GNPS
BioModels
FAIRDOMHub

ArrayExpress
dbGaP
ExpressionAtlas
GEO
NODE

Information

Databases
Help
API
Contact us
Code on GitHub
Terms of use
Submit Data