Browse
Submit Data
Databases
API
Help

Dataset Information

0 Views

0 Connections

0 Citations

0 Reanalyses

0 Downloads

Omics score: 0

ABSTRACT: Aptamer sequence library from SELEX

PROVIDER: PRJNA1176306 | ENA |

REPOSITORIES: ENA

ACCESS DATA

Json Xml

Dataset's files

Source:

			Action	DRS
	SRR31113906_1.fastq.gz	Fastqsanger.gz
	SRR31113906_2.fastq.gz	Fastqsanger.gz
	SRR31121239.fastq.gz	Fastqsanger.gz
	SRR31121240.fastq.gz	Fastqsanger.gz
	SRR31121241.fastq.gz	Fastqsanger.gz

Items per page:

1 - 5 of 34

Similar Datasets

A sputum bioassay for airway eosinophilia using an eosinophil peroxidase aptamer

Project description:We genearted a DNA aptamer against EPX via SELEX protocol using a random DNA library and developed an assay to monitor EPX in patients spitum samples After 15 rounds of selection, the aptamer sequences were obtained by high throughput sequencing

2022-09-25 | GSE213923 | GEO

Project description:DNA aptamer of ASFV p30, SELEX library sequencing

| PRJNA990511 | ENA

Project description:Covalent aptamer library

| PRJNA1119072 | ENA

Quantitative modeling of transcription factor binding specificities using DNA shape

Project description:The SELEX-seq platform was used to generate DNA-binding affinity predictions for the human Max transcription factor. This experiment was performed as part of a cross-validation study comparing the accuracy of DNA shape-augmented TF binding specificity models across two different platforms (SELEX-seq and gcPBM) Two rounds of SELEX were performed on Max protein as described in Slattery et al, Cell, 2011 (PMID 22153072). Briefly, His-tagged Max was incubated with a randomized 16mer oligonucleotide library (GTTCAGAGTTCTACAGTCCGACGATCTGG[ACGT]{16}CCAGAACTCGTATGCCGTCTTCTGCTTG). Max bound DNA was amplified and sequenced as described (Slattery et al, 2011).

2015-03-01 | E-GEOD-60200 | biostudies-arrayexpress

ssDNA aptamers targeting Salmonella paratyphi A [SELEX]

Project description:Here, we report an ssDNA aptamer with high specificity and affinity towards Salmonella paratyphi A generated using the whole-cell SELEX process. The aptamers generated against an organism show salient features, such as higher affinity than existing antibodies, and are highly specific towards the targeted organism. Thus, the generated aptamer sequences can serve as potential biomarkers for the onsite detection of pathogens with high specificity and sensitivity. Molecular dynamics simulation was used to model the linear chain of the aptamers to a three-dimensional conformation, and the binding mechanism against DNA gyrase was established.

2019-12-31 | GSE137006 | GEO

HT-SELEX of recombinant C2H2 zinc finger domains of Sall4

Project description:To define the sequence preference of SALL4 C2H2 zinc finger domains, we performed SELEX coupled with high-throughput sequencing (HT-SELEX) using the purified SALL4 ZFC1, ZFC2 and ZFC4 domains combined with no protein control experiment. We re-sequenced the libraries from E-MTAB-9236 with very high coverage to estimate the minimum number of reads required per sample for accurate results.

2022-03-01 | E-MTAB-11484 | biostudies-arrayexpress

Project description:Improving Aptamer Affinity and Determining Sequence-Activity Relationships via Motif-SELEX

| PRJNA1188194 | ENA