Ontology highlight
ABSTRACT:
PROVIDER: PRJNA1188194 | ENA |
REPOSITORIES: ENA
Dataset's files
| Action | DRS | |||
|---|---|---|---|---|
| SRR31416605_1.fastq.gz | Fastqsanger.gz | |||
| SRR31416605_2.fastq.gz | Fastqsanger.gz | |||
| SRR31416606_1.fastq.gz | Fastqsanger.gz | |||
| SRR31416606_2.fastq.gz | Fastqsanger.gz | |||
| SRR31416607_1.fastq.gz | Fastqsanger.gz |
Items per page: 5 1 - 5 of 16 |
Similar Datasets
Project description:We genearted a DNA aptamer against EPX via SELEX protocol using a random DNA library and developed an assay to monitor EPX in patients spitum samples After 15 rounds of selection, the aptamer sequences were obtained by high throughput sequencing
2022-09-25 | GSE213923 | GEO
Project description:Here, we report an ssDNA aptamer with high specificity and affinity towards Salmonella paratyphi A generated using the whole-cell SELEX process. The aptamers generated against an organism show salient features, such as higher affinity than existing antibodies, and are highly specific towards the targeted organism. Thus, the generated aptamer sequences can serve as potential biomarkers for the onsite detection of pathogens with high specificity and sensitivity. Molecular dynamics simulation was used to model the linear chain of the aptamers to a three-dimensional conformation, and the binding mechanism against DNA gyrase was established.
2019-12-31 | GSE137006 | GEO
Project description:We report high-affinity ssDNA aptamers as biomarkers and antagonists of amyloid-β peptide. We generated three novel aptamer sequences from the pool of aptamers through the SELEX process, and evaluated their affinity and sensitivity using enzyme-linked immunosorbent assay (ELISA). (The forward primer: ATTAGTCAAGAGGTAGACGCACATA, reverse primer TTCTGGTCGTCGTGACTCCTAT) The ssDNA aptamers modeled into a three-dimensional structure; interaction and mechanism of action derived through molecular dynamics simulations (MD). MD simulations revealed the nature of binding and inhibition of aggregation by binding with amyloid-β peptide monomers, dimers, and other oligomers. The presence of high non-bonded interaction energy along with hydrogen bonds constitutes the complex structure of the aptamer-amyloid-β peptide. Furthermore, the changes in the secondary structure induced by aptamers may help remove the peptide through the blood-brain barrier. This study provided a framework for the application of aptamers against amyloid-β peptides as biomarkers and antagonists.
2019-09-30 | GSE124865 | GEO
Project description:Sequence-specific DNA-binding transcription factors are central to gene regulation. They are often associated with consensus binding sites that predict far more genomic sites than are bound in vivo. One explanation is that most sites are blocked by nucleosomes, such that only sites in nucleosome-depleted regulatory regions are bound. Alternatively, the consensus site may be poorly defined. We compared the binding of the yeast transcription factor Gcn4 in vivo using published ChIP-seq data (546 sites) and in vitro, using a modified SELEX method ("G-SELEX"), which utilizes short genomic DNA fragments to quantify binding at all sites. We confirm that Gcn4 binds strongly to an AP1-like sequence (TGACTCA) and weakly to half-sites. However, Gcn4 binds only some of the 1078 exact matches to this sequence, even in vitro. We show that the high-affinity site is RTGACTCAY (exact match), of which there are only 166 copies in the yeast genome, all occupied in vivo. Generally, RTGACTCAR/YTGACTCAY sites are bound much more weakly and YTGACTCAR sites are unbound, with biological implications for determining induction levels. We conclude that Gcn4 binding can be predicted using the genome sequence. Our study suggests that transcription factor consensus sequences should be defined more precisely using quantitative data.
2021-12-06 | GSE180114 | GEO
Project description:The tRNA linked repeat sequence rrB was tagged in either 5'- or 3'- end with the MS2 aptamer and expressed from a plasmid in E. coli. Using the MS2 aptamer, the RNAs were affinity purified after cell lysis. The co-purifying proteins were identified by NanoLC-MS/MS and compared to the proteins co-purifying with the MS2 sequence alone.
2021-04-26 | PXD013749 | Pride
Project description:The glucocorticoid receptor (GR) binds to DNA in at least three stoichiometric ratios to regulate gene expression. The dimeric binding of GR to a 15 base pair core sequence has been well studied, and is associated with activation of gene expression. Monomeric GR has been associated with repression. GR has also been shown to form tetramers on DNA in live cells. The role of DNA sequence in directing DNA-binding stoichiometry and subsequent gene regulation is not clear. We took an unbiased approach using SELEX-seq to calculate comprehensive monomeric- and dimeric-binding profiles for GR. The monomeric site is composed of a canonical half-site, but is distinguished from the dimer site by a downstream TTTg motif and the absence of a second half-site. To probe the mechanism of how this motif favors monomeric binding, we performed Spec-/Coop-seq. The TTTg increases monomeric affinity while decreasing cooperative dimeric binding. Crystal structures indicated that TTTg results in a narrowed minor groove bringing residues Y455 and K471 of GR into the proximity of DNA, increasing affinity. Interestingly, although monomeric binding is more often associated with repression of gene expression than dimeric binding, the trend is not significant. Consistent with live-cell imaging, a meta-analysis of GR:DNA structures reveals that, regardless of binding sequence, GR binds to DNA as a dimer of dimers using highly similar interfaces. This suggests that the functional stoichiometry of GR in the cell is tetrameric, and that sequence may modulate GR activity.
2018-12-01 | GSE107584 | GEO
Project description:A long-standing challenge in human regulatory genomics is that transcription factor (TF) DNA-binding motifs are short and degenerate, while the genome is large. Motif scans therefore produce many false-positive binding site predictions. By surveying TFs across 25 families using >1,500 cyclic in vitro selection experiments with fragmented, naked, and unmodified genomic DNA – a method we term GHT-SELEX (Genomic HT-SELEX) – we find that many human TFs possess much higher sequence specificity than anticipated. Moreover, genomic binding regions from GHT-SELEX are often surprisingly similar to those obtained in vivo (i.e. ChIP-seq peaks). We find that comparable specificity can also be obtained from motif scans, but performance is highly dependent on derivation and use of the motifs, including accounting for multiple local matches in the scans. We also observe alternative engagement of multiple DNA-binding domains within the same protein: long C2H2 zinc finger proteins often utilize modular DNA recognition, engaging different subsets of their DNA binding domain (DBD) arrays to recognize multiple types of distinct target sites, frequently evolving via internal duplication and divergence of one or more DBDs. Thus, contrary to conventional wisdom, it is common for TFs to possess sufficient intrinsic specificity to independently delineate cellular targets.
2024-11-11 | GSE278858 | GEO
Project description:The SELEX-seq platform was used to generate DNA-binding affinity predictions for the human Max transcription factor. This experiment was performed as part of a cross-validation study comparing the accuracy of DNA shape-augmented TF binding specificity models across two different platforms (SELEX-seq and gcPBM) Two rounds of SELEX were performed on Max protein as described in Slattery et al, Cell, 2011 (PMID 22153072). Briefly, His-tagged Max was incubated with a randomized 16mer oligonucleotide library (GTTCAGAGTTCTACAGTCCGACGATCTGG[ACGT]{16}CCAGAACTCGTATGCCGTCTTCTGCTTG). Max bound DNA was amplified and sequenced as described (Slattery et al, 2011).
2015-03-01 | E-GEOD-60200 | biostudies-arrayexpress
Project description:The SELEX-seq platform was used to generate DNA-binding affinity predictions for the human Max transcription factor. This experiment was performed as part of a cross-validation study comparing the accuracy of DNA shape-augmented TF binding specificity models across two different platforms (SELEX-seq and gcPBM)
2015-03-01 | GSE60200 | GEO