Homo sapiens
Ontology highlight
ABSTRACT:
PROVIDER: PRJNA207662 | ENA |
REPOSITORIES: ENA
Similar Datasets
Project description:Gene expression profiling of LNCaP prostate cancer cells that have JMJD2A knockdown (JMJD2A shRNA #3; JMJD2A shRNA #5) or ETV knockdown (ETV shRNA #1; ETC shRNA #5) were compared to non-targeted control (sh-cm) cells. Total RNA was isolated from transformed LNCaP human prostate cancer cells containing a non-trageting control vector (sh-cm), vectors containing shRNA sequences for JMJD2A or ETV1 genes.
2014-01-01 | E-GEOD-47750 | biostudies-arrayexpress
Project description:Gene expression profiling of LNCaP prostate cancer cells that have JMJD2A knockdown (JMJD2A shRNA #3; JMJD2A shRNA #5) or ETV knockdown (ETV shRNA #1; ETC shRNA #5) were compared to non-targeted control (sh-cm) cells.
2014-01-01 | GSE47750 | GEO
Project description:Gene expression profile of ETV1 knockdown in LNCaP prostate cancer cells
| PRJNA202375 | ENA
Project description:The protein Glycine-N-Acyltransferase Like 1 (GLYATL1) is involved in detoxification of benzoate and other xenobiotics and is expressed in liver and kidney. Through In silico analysis of cancer gene expression profiling and transcriptome sequencing we revealed an overexpression of GLYATL1 in primary prostate cancer. Confirming these findings by immunohistochemistry we show that GLYATL1 is overexpressed in primary prostate cancer compared to metastatic prostate cancer and benign prostatic tissue. Low grade cancers had higher GLYATL1 expression compared to high grade prostate tumors. Our studies showed that GLYATL1 is upregulated upon androgen treatment in LNCaP prostate cancer cells which harbors ETV1 gene rearrangement. Furthermore, ETV1 knockdown in LNCaP cells showed downregulation of GLYATL1 suggesting potential regulation of GLYATL1 by ETS transcription factor ETV1. Transcriptome sequencing using the GLYATL1 knockdown prostate cancer cell lines LNCaP showed regulation of multiple metabolic pathways. In summary, our study characterizes the expression GLYATL1 in prostate cancer and explore its regulation mechanism. Future studies are needed to decipher the biological significance of these findings.
2019-12-17 | GSE130395 | GEO
Project description:Over half of prostate cancer harbor overexpression of ETS transcription factors including ERG and ETV1. LNCaP prostate cancer cells have an ETV1 translocation to the MIPOL1 locus on 14q13.3-13q21.1. To determine genes regulated by ETV1, we performed shRNA mediated knockdown of ETV1 using two lentiviral constructs as well as a scrambled shRNA in triplicate. Two pLKO.1 constructs against ETV1 (ETV1sh1: TRCN0000013923, targeting GTGGGAGTAATCTAAACATTT in 3'(B UTR; and ETV1sh2: TRCN0000013925, targeting CGACCCAGTGTATGAACACAA in exon 7) were purchased from Open Biosystems and pLKO.1 shScr (targeting CCTAAGGTTAAGTCGCCCTCG) was purchased from Addgene. RNA was harvested 3 days after infection and gene expression profiling was performed. Among genes downregulated were many well characterized androgen regulated genes. LNCaP cells logarthmically growing in full serum was infected with three different shRNA lentiviruses. Three days after infection
2013-05-10 | E-GEOD-46329 | biostudies-arrayexpress
Project description:Over half of prostate cancer harbor overexpression of ETS transcription factors including ERG and ETV1. LNCaP prostate cancer cells have an ETV1 translocation to the MIPOL1 locus on 14q13.3-13q21.1. To determine genes regulated by ETV1, we performed shRNA mediated knockdown of ETV1 using two lentiviral constructs as well as a scrambled shRNA in triplicate. Two pLKO.1 constructs against ETV1 (ETV1sh1: TRCN0000013923, targeting GTGGGAGTAATCTAAACATTT in 3'(B UTR; and ETV1sh2: TRCN0000013925, targeting CGACCCAGTGTATGAACACAA in exon 7) were purchased from Open Biosystems and pLKO.1 shScr (targeting CCTAAGGTTAAGTCGCCCTCG) was purchased from Addgene. RNA was harvested 3 days after infection and gene expression profiling was performed. Among genes downregulated were many well characterized androgen regulated genes.
2013-05-10 | GSE46329 | GEO
Project description:Expression profiling of human prostate non-tumorigenic RWPE-1 cells after overexpressing ERG and ETV1, and ERG and ETV1 silencing on prostate cancer cells LNCaP and VCaP, respectively
| PRJNA170742 | ENA
Project description:Gene expression profiling of immortalized human mesenchymal stem cells with hTERT/E6/E7 transfected MSCs. hTERT may change gene expression in MSCs. Goal was to determine the gene expressions of immortalized MSCs.
2010-09-25 | GSE24338 | GEO
Project description:Transcriptional effect of ETV1 knockdown in melanoma cells
| PRJNA319396 | ENA
Project description:Expression profiling of human prostate VCaP and LNCaP cancer cells after silencing ERG or ETV1, respectively
| PRJNA170744 | ENA