Searching for new molecules involved in Anopheles mosquitoes’ response to Plasmodium infection
Ontology highlight
ABSTRACT:
PROVIDER: PRJNA809222 | ENA |
REPOSITORIES: ENA
Dataset's files
| Action | DRS | |||
|---|---|---|---|---|
| SRR18097069_1.fastq.gz | Fastqsanger.gz | |||
| SRR18097069_2.fastq.gz | Fastqsanger.gz | |||
| SRR18097070_1.fastq.gz | Fastqsanger.gz | |||
| SRR18097070_2.fastq.gz | Fastqsanger.gz | |||
| SRR18097071_1.fastq.gz | Fastqsanger.gz |
Items per page: 5 1 - 5 of 16 |
Similar Datasets
Project description:Plasmodium parasites within mosquitoes are exposed to various physiological processes, such as blood meal digestion activity, the gonotrophic cycle, and host responses preventing the entry of parasites into the midgut wall. However, when in vitro-cultured ookinetes are injected into the hemocoel of mosquitoes, Plasmodium parasites are not affected by the vertebrate host’s blood contents and do not pass through the midgut epithelial cells. This infection method might aid in identifying mosquito-derived factors affecting Plasmodium development within mosquitoes. This study investigated novel mosquito-derived molecules related to parasite development in Anopheles mosquitoes. We injected in vitro-cultured Plasmodium berghei (ANKA strain) ookinetes into female and male Anopheles stephensi (STE2 strain) mosquitoes and found that the oocyst number was significantly higher in males than in females, suggesting that male mosquitoes better support the development of parasites. Next, RNA-seq analysis was performed on the injected female and male mosquitoes to identify genes exhibiting changes in expression. Five genes with different expression patterns between sexes and greatest expression changes were identified as being potentially associated with Plasmodium infection. Two of the five genes also showed expression changes with infection by blood-feeding, indicating that these genes could affect the development of Plasmodium parasites in mosquitoes.
2024-05-06 | GSE197159 | GEO
Project description:In the present study, we have investigated the effect of CpG Oligodeoxynucleotides (CpG-ODN) on the outcome of Plasmodium infection of the mosquito vectors Anopheles stephensi and Anopheles gambiae and on the modulation of mosquito immunity to Plasmodium. Anopheles mosquitoes inoculated with CpG-ODN showed significant reduction of Plasmodium infection rate and intensity. Microarrays were used to profile transcription of fat-body from CpG-ODN-treated mosquitoes. Mosquitoes were dissected 18h after ODN inoculation (immediately before feeding). Batches of 20 to 30 fat bodies (abdomen without midgut, ovaries and malpighian tubule]) were dissected in cold DEPC-treated phosphate-buffered saline (PBS) and processed for RNA preparation. Mosquitoes treated with CpG-ODNs are less susceptible to Plasmodium infection. Transcription profile of fat body indicates that protection was associated with coagulation/wound healing, while melanization appears to be depressed.
2013-04-02 | GSE26941 | GEO
Project description:In the present study, we have investigated the effect of CpG Oligodeoxynucleotides (CpG-ODN) on the outcome of Plasmodium infection of the mosquito vectors Anopheles stephensi and Anopheles gambiae and on the modulation of mosquito immunity to Plasmodium. Anopheles mosquitoes inoculated with CpG-ODN showed significant reduction of Plasmodium infection rate and intensity. Microarrays were used to profile transcription of fat-body from CpG-ODN-treated mosquitoes. Mosquitoes were dissected 18h after ODN inoculation (immediately before feeding). Batches of 20 to 30 fat bodies (abdomen without midgut, ovaries and malpighian tubule]) were dissected in cold DEPC-treated phosphate-buffered saline (PBS) and processed for RNA preparation. Mosquitoes treated with CpG-ODNs are less susceptible to Plasmodium infection. Transcription profile of fat body indicates that protection was associated with coagulation/wound healing, while melanization appears to be depressed. Anopheles gambiae s.s. mosquitoes were reared at 25 M-BM-:C and 75% humidity with a 12-hour light/dark cycle. Adult mosquitoes were maintained on a 10% glucose solution. Three- to four-day-old female mosquitoes were cold-anaesthetized and inoculated intratoraxically with 69nl of a 0.1mM CpG-oligodeoxynucleotide (0604 -5M-bM-^@M-^Y TCCATGACGTTCCTGATGCT 3M-bM-^@M-^Y) solution or with the same volume of elution buffer using a Nanoject micro-injector (Drummond Scientific). Mosquitoes were left to rest for 18h. Batches of 20 to 30 fat bodies (abdomen without midgut, ovaries and malpighian tubule) were dissected in cold DEPC-treated phosphate-buffered saline (PBS) and processed for RNA preparation. Two independent experiments were performed for each treatment.
2013-04-02 | E-GEOD-26941 | biostudies-arrayexpress
Project description:we report the RNA-seq based analyses of the transcriptional changes in the Anopheles gambiae mosquitoes from East Africa classified as deltamethrin-resistant or -suscpetible accordign the WHO test
2012-10-01 | GSE39269 | GEO
Project description:we report the RNA-seq based analyses of the transcriptional changes in the Anopheles gambiae mosquitoes from East Africa classified as deltamethrin-resistant or -suscpetible accordign the WHO test comparison of the transcriptome of Anopheles gambiae mosquitoes with phenotypically resistant or suscpetible to deltamethrin
2012-10-01 | E-GEOD-39269 | biostudies-arrayexpress
Project description:Mosquitoes are the vectors of a variety of infectious diseases. Olfaction and circadian rhythm gate different behavioral events in mosquitoes. However, the mechanisms of odor detection and processing of chemical signals, which are essential for olfactory perception, is poorly understood, including how perception changes in response to zeitgeber time in different mosquito species. To this end, we performed a circadian-dependent RNA-Sequencing study of the brain and peripheral olfactory-tissues of female Anopheles and Aedes mosquitoes. Data analysis revealed a significant upregulation of genes encoding: (a) chemosensory proteins (CSPs), required for transportation of odorant molecules towards the olfactory receptors, and; (b) xenobiotic-metabolizing enzymes (XMEs) during the dusk-transition phase. While XMEs primarily function in the elimination of toxic xenobiotics, concurrent elevation of XMEs and CSPs are hypothesized to act cumulatively for the regulation of perireceptor events and odorant sensitivity. During navigation towards their vertebrate-host/floral-host/mate-partners, female mosquitoes are exposed to diverse environmental chemicals of varied release rates that require continuous degradation/biotransformation by XMEs to avoid receptor saturation in such a noisy environment. Finally, our electroantennographic (EAG) analysis with both Anopheles and Aedes mosquitoes against diverse active volatile odorants, combined with XMEs inhibitors and RNAi studies, establish the proof-of-concept that XMEs function in peri-receptor events during odorant perception and influence the odorant sensitivity in mosquitoes. Additionally, our RNA-Seq and RNAi data also revealed that daily temporal modulation of neuronal serine proteases may facilitate the reorganization of synaptic connections influencing synaptic plasticity and olfactory perception in mosquitoes. In summary, this study highlights the crucial function of XMEs in odorant reception, therefore, improved understanding of species-specific rhythmic expression may provide an important information for successful implementation of mosquito control methods.
2025-01-01 | GSE238168 | GEO
Project description:Detoxification genes were assayed for their response to Plasmodium berghei infection at 1 and 11 days post infection in Anopheles gambiae mosquitoes.
2010-08-11 | E-MTAB-195 | biostudies-arrayexpress
Project description:Transmission of malaria is dependent on the successful completion of the Plasmodium lifecycle in the Anopheles vector. Major obstacles are encountered in the midgut tissue, where most parasites are killed by the mosquito’s immune system. In the present study, DNA microarray analyses have been used to compare Anopheles gambiae responses to invasion of the midgut epithelium by the ookinete stage of the human pathogen Plasmodium falciparum and the rodent experimental model pathogen P. berghei. Invasion by P. berghei had a more profound impact on the mosquito transcriptome, including a variety of functional gene classes, while P. falciparum elicited a broader immune response at the gene transcript level. Ingestion of human malaria-infected blood lacking invasive ookinetes also induced a variety of immune genes, including several anti-Plasmodium factors. By comparing gene expression patterns between carcassess or guts of mosquitoes that fed on a P. falciparum or P. berghei wt and mosquitoes that fed on invasion incapable strains we gain information on the A. gambiae transcriptional responses to the invading ookinete at 24 hours after feeding. By comparing gene expression patterns between carcassess or guts of mosquitoes that fed on a P. falciparum ookinete invasion incapable strain and mosquitoes that fed on non-infected blood we gain information on the A. gambiae transcriptional responses to malaria infected blood in absence of ookinete invasion at 24 hours after feeding. By comparing gene expression patterns between mosquitoes at 4 hours after being injected with either E. coli or S. aureus and mosquitoes injected with sterile PBS we gain information on the mosquito's transcriptional response to these bacterial challenges.
2007-08-15 | E-GEOD-8789 | biostudies-arrayexpress
Project description:Mosquitoes possess an innate immune system that is capable of limiting infection by a variety of pathogens, including the Plasmodium spp. parasites responsible for human malaria. The Anopheles immune deficiency (IMD) innate immune signaling pathway confers resistance to Plasmodium falciparum. While some previously identified Anopheles anti-Plasmodium effectors are regulated through signaling by Rel2, the transcription factor of the IMD pathway, many components of this defense system remain uncharacterized. To begin to better understand the regulation of immune effector proteins by the IMD pathway, we used oligonucleotide microarrays and iTRAQ to analyze differences in mRNA and protein expression, respectively, between transgenic An. stephensi mosquitoes exhibiting blood meal-inducible overexpression of an active recombinant Rel2 and their wild-type conspecifics. Numerous genes were differentially regulated at both the mRNA and protein levels following induction of Rel2. While multiple immune genes were up-regulated, a majority of the differentially expressed genes have no known immune function in mosquitoes. Identified sequences were assigned putative functions and gene ontology (GO) terms based on homology to previously annotated A. gambiae gene sequences. Selected up-regulated genes from multiple GO categories were tested for both anti-Plasmodium and anti-bacterial action using RNA interference (RNAi). Based on our experimental findings, we conclude that increased expression of the IMD immune pathway-controlled transcription factor Rel2 affects the expression of numerous genes with diverse functions, suggesting a broader physiological impact of immune activation and possible functional versatility of Rel2. Our study has identified multiple novel anti-Plasmodium effectors.
2014-07-11 | GSE59258 | GEO
Project description:Changes in gene expression in whole Anopheles gambiae female bodies between virgin mosquitoes and females samples at 2h, 6h, and 24h after mating.
2009-01-01 | E-MEXP-1868 | biostudies-arrayexpress